ID: 981257739

View in Genome Browser
Species Human (GRCh38)
Location 4:142683093-142683115
Sequence AAGGAGACTTAGGAGTTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981257739 Original CRISPR AAGGAGACTTAGGAGTTCAT GGG (reversed) Intronic
904355345 1:29935120-29935142 AAGGAGACTCAGGAGGGCAGGGG - Intergenic
907069500 1:51520776-51520798 GAGTAGAATTAGGAGTTCCTTGG - Intergenic
907800096 1:57756332-57756354 ACTGAGATATAGGAGTTCATAGG + Intronic
911662153 1:100513178-100513200 AAAGAGACATAGGAGTACAGAGG + Intronic
911780560 1:101870686-101870708 AAGCAAACTTAGGAGATAATGGG + Intronic
912404908 1:109428995-109429017 AAGGGGAATGAGGAGTTAATGGG + Intergenic
913259980 1:116989060-116989082 AAGGAGATTCAGGATTTTATTGG + Exonic
916053013 1:161049164-161049186 AAGGGGACTTAGGTCATCATAGG + Exonic
920701857 1:208223918-208223940 AAGGAGCCTTCTGAGATCATTGG - Intronic
920949273 1:210557289-210557311 AAGGACACTTTGAGGTTCATGGG - Intronic
922037277 1:221861200-221861222 AAGGAGAGAAAAGAGTTCATGGG - Intergenic
922537400 1:226391290-226391312 AAAGAGACTAAGGAGGCCATAGG - Intronic
923488013 1:234454904-234454926 GAGGACACTTAGGATTACATTGG - Intronic
1064094927 10:12417215-12417237 AAGAAGACTCAGAAGGTCATAGG - Intronic
1065798775 10:29331973-29331995 GAGGCGACTCATGAGTTCATTGG - Intergenic
1066800114 10:39178112-39178134 ATGGACACTTGGGAGTTCATGGG + Intergenic
1067197360 10:44133605-44133627 AAGGAGACTTAGGTGAACAGGGG + Intergenic
1068234767 10:54219293-54219315 AAGGAGACTTAGGAGAGGCTGGG + Intronic
1068632297 10:59310691-59310713 AAGCATCCTTGGGAGTTCATTGG - Intronic
1069399242 10:68024918-68024940 AAGGAGAATTAGGAGATTATTGG + Intronic
1069407099 10:68113329-68113351 TAGGTTACTTAGGAGTTCTTTGG + Intronic
1069810002 10:71151742-71151764 AAGGATACTTAAGAGGTCAGTGG + Intergenic
1070772133 10:79088628-79088650 AAGGAGGCTTAGGGGTCCCTGGG + Intronic
1072606093 10:96983925-96983947 ACGGAAATGTAGGAGTTCATTGG + Exonic
1073140456 10:101243677-101243699 TAGGAGACTCAGAAGTCCATTGG - Intergenic
1075978492 10:126717590-126717612 AAGGACCCTTAAGAGTACATTGG - Intergenic
1078542075 11:12220850-12220872 AAGGAGACTTTGGGGCCCATAGG - Intronic
1079085389 11:17441205-17441227 AAGAAGACTTAGGACACCATGGG - Intronic
1079771001 11:24459753-24459775 AGAGAGATTTAGGAGTTAATAGG + Intergenic
1080871992 11:36244472-36244494 AAGGACACTTATGATTACATTGG + Intergenic
1081291113 11:41327073-41327095 CAGGAGACTGAGGATTTAATTGG + Intronic
1081350519 11:42046204-42046226 AAGGAGACTTGTGACTACATTGG - Intergenic
1082302071 11:50518909-50518931 ATGGACATTTGGGAGTTCATTGG - Intergenic
1084464596 11:69314760-69314782 AAGGATGAGTAGGAGTTCATTGG + Intronic
1087643526 11:100781378-100781400 AAGGAGACTTTGGTGAGCATGGG + Intronic
1087734279 11:101814228-101814250 AAAGAGAGTGAGGAGTTGATAGG + Intronic
1094364631 12:29667135-29667157 AAGGAAACTTAAGTGTTTATGGG + Intronic
1094457465 12:30653202-30653224 AGGGAGGCTTATGAGTACATTGG - Intronic
1095554323 12:43482715-43482737 AAGGACACTTGGGAGTTCCATGG + Intronic
1095765780 12:45893998-45894020 GAGGAAACTTAGGAGTTTATTGG + Intronic
1097155455 12:57008800-57008822 AAGGAGCCTGAGGATTTCACTGG + Intergenic
1097796189 12:63864728-63864750 GAGGAGCCTAAGGAGTACATGGG + Intronic
1098237218 12:68428724-68428746 AAGCAGACTGAGAAGTTCAGAGG + Intergenic
1099296726 12:80837380-80837402 AAGGATACTTGTGAGTTCTTAGG - Intronic
1099883763 12:88501534-88501556 AACTAGACTTAAGAGTTCCTTGG + Intronic
1103206655 12:119134884-119134906 AAGGATGCATAGGAGTTCATTGG + Intronic
1103372377 12:120429519-120429541 CAGGCGACTTAGAAGTTAATGGG + Intergenic
1106672151 13:31917688-31917710 CACGATATTTAGGAGTTCATAGG + Intergenic
1107236975 13:38182958-38182980 AATGAGATTTAAGAGTTCATAGG - Intergenic
1108368508 13:49743013-49743035 AAAGAGACTTAGGAGTTATTTGG + Intronic
1110151764 13:72263875-72263897 TTGGATAATTAGGAGTTCATTGG + Intergenic
1110208258 13:72943701-72943723 AAGGAGACTGAGGAGTACGAAGG - Intronic
1110253014 13:73401897-73401919 AAGGAGACTTAAAAGTTGAGTGG - Intergenic
1111567935 13:90041245-90041267 AAGGAGAAATAGGAGTTGTTAGG + Intergenic
1112975859 13:105316042-105316064 GAGGTGACCTATGAGTTCATTGG + Intergenic
1116786969 14:49298174-49298196 GAGGAGACTCAGAAGTTCAGAGG - Intergenic
1117998077 14:61496711-61496733 CAGGAGAGTTAGGTGTTCTTAGG + Intronic
1120431399 14:84420459-84420481 AAAGGTACTTAGAAGTTCATAGG - Intergenic
1123898540 15:24852360-24852382 ATGGAAACTTAGGCGATCATTGG + Intronic
1124930877 15:34118249-34118271 AAGGAGCATTAGGAGTTCTCGGG + Intergenic
1125898347 15:43321732-43321754 AAGGAGGATCAGGAGTGCATGGG - Intergenic
1126939915 15:53756005-53756027 AAGGAGAATAAGGATTTCACAGG + Intronic
1128532959 15:68467398-68467420 AAGGAGAATATGGACTTCATGGG - Intergenic
1129354963 15:74984128-74984150 TAGTAGACTTCTGAGTTCATAGG - Intronic
1129529508 15:76252249-76252271 AAGGAAACCCAGGAGTTCAAGGG - Intronic
1133472623 16:6090200-6090222 AAGGAGACTTGTGACTACATTGG + Intronic
1134685177 16:16153539-16153561 AAGGAGAGTTAGGGTTTCATGGG + Intronic
1135153064 16:20026826-20026848 AAAGTGACTTAGGAGTTGAGGGG - Intergenic
1136276834 16:29183787-29183809 AAGGATAAGTAGGAGTTCACTGG - Intergenic
1136677487 16:31925021-31925043 AAGGAGACTCTGGAGGGCATTGG - Intergenic
1136738195 16:32483435-32483457 AAGGACATTTTGGAGCTCATTGG + Intergenic
1137059388 16:35774326-35774348 AGGGACATTTAGGATTTCATTGG - Intergenic
1137597601 16:49735195-49735217 AAAGAGACTTGGAAGTTTATGGG - Intronic
1139274340 16:65713631-65713653 AAGGATCCTTAGGATTTCCTGGG + Intergenic
1140044294 16:71430496-71430518 AAGGTGACTTGGGAGTTCATAGG + Intergenic
1140060674 16:71566781-71566803 AATGAGACTGAGGAGTGCCTGGG + Exonic
1140732782 16:77871516-77871538 AAGGTGAATTAGGGTTTCATAGG - Intronic
1140972351 16:80025468-80025490 AAGCAGATTTAAGATTTCATGGG + Intergenic
1141231790 16:82174377-82174399 AAGGATACTGGGTAGTTCATAGG + Intergenic
1142081212 16:88149847-88149869 AAGGATAAGTAGGAGTTCACTGG - Intergenic
1203014878 16_KI270728v1_random:346138-346160 AAGGACATTTTGGAGCTCATTGG - Intergenic
1203033213 16_KI270728v1_random:619297-619319 AAGGACATTTTGGAGCTCATTGG - Intergenic
1142777044 17:2148927-2148949 ATGGAGACTTATTATTTCATGGG + Intronic
1144382398 17:14715159-14715181 AAGGAAACTTAGGAGTATCTTGG - Intergenic
1144829674 17:18124235-18124257 CAGGACACTTGGGAGCTCATGGG + Intronic
1145181672 17:20758466-20758488 ACTGAGTCTTAGGAGTTCCTGGG + Intergenic
1147281835 17:39368489-39368511 AAAGAGACTTAGGACTTGGTAGG - Intronic
1147731729 17:42608250-42608272 AAGTGGACCTAGGACTTCATAGG - Intronic
1148188216 17:45660051-45660073 AAGGAGACTTGGGATGTGATGGG - Intergenic
1149841556 17:59969414-59969436 ACTGAGTCTTAGGAGTTCCTGGG + Intronic
1151683673 17:75634761-75634783 AGGGAGATCTAGGAGTTTATGGG - Intronic
1153295057 18:3537237-3537259 ATGGAGAGTTAGCATTTCATGGG - Intronic
1155163318 18:23212842-23212864 AAGAATAAATAGGAGTTCATTGG + Intronic
1155170815 18:23265675-23265697 ACTGAGACTTTGGAGTTCTTGGG + Intronic
1155462204 18:26095490-26095512 AAGGACACTTATGATTTCACTGG - Intergenic
1157296543 18:46448908-46448930 AAGGAGACTGAGGAGCTGAGTGG - Intronic
1157729674 18:49992636-49992658 AATGAGAGTAACGAGTTCATTGG + Intronic
1157894896 18:51456683-51456705 AAGGAGAATTAGGTGTTGCTAGG + Intergenic
1162870655 19:13584015-13584037 AAGGAGACTGTGGAGCTTATTGG - Intronic
1164338965 19:24366698-24366720 AAGGATATTTGGGAGTGCATTGG + Intergenic
1164359758 19:27491972-27491994 AAGGACACTTGGAAGTGCATTGG + Intergenic
1166511227 19:43410276-43410298 AAGGACAATTAGGAGTTTGTGGG + Intronic
926426857 2:12746121-12746143 AAGAAGATTTAGGTGTTCAAAGG - Intergenic
926747577 2:16171625-16171647 AAGGATGCTCAGGATTTCATTGG + Intergenic
928333042 2:30372289-30372311 AAGGAGAGTCAGGAGGCCATTGG - Intergenic
928727018 2:34186269-34186291 AAGGAAAGTTAGGAATACATTGG - Intergenic
930041457 2:47128453-47128475 CAGGAAACTTAGGAATTTATTGG + Intronic
933761852 2:85678034-85678056 AAGGAGAGTTAGTGTTTCATGGG - Intergenic
935359811 2:102237808-102237830 AAGGAGGTTTAAGAGTTCAACGG + Intronic
935542352 2:104363363-104363385 AAGGAAAATTAGGAGCACATAGG + Intergenic
939298547 2:140302954-140302976 ATGGAGCCTGAGGAGTTCAATGG - Intronic
941019931 2:160397140-160397162 AAGGAGCCATGGGAGTTCAGAGG - Intronic
941538527 2:166752932-166752954 ATGGAGTCTTAGGAGTGCAGTGG - Intergenic
943799468 2:192039859-192039881 AAGGAGACTAAGGAATACAGTGG + Intronic
947032203 2:225809349-225809371 AAGGAGCTTCAAGAGTTCATGGG + Intergenic
947767723 2:232648239-232648261 AAGGAGAGCTGGGAGTTTATCGG + Intronic
1173376412 20:42487550-42487572 AAGGACCCTTATGAGTACATGGG - Intronic
1174263373 20:49313630-49313652 AAGGAGACTGGGAACTTCATAGG + Intergenic
1174703424 20:52632153-52632175 AAGAAGAGTTTGGAGTCCATAGG + Intergenic
1178676155 21:34633496-34633518 AAGGACACTTAAGACTACATTGG + Intergenic
1183277993 22:36913461-36913483 AAGGAGGCCTAGGAGTTTATAGG + Intergenic
949850371 3:8414325-8414347 AATGACACTTAGGATTCCATTGG + Intergenic
950523911 3:13512589-13512611 AAGGAGACGTTGGACTGCATGGG - Intergenic
951658573 3:25036774-25036796 AAGCACACTTAGGAGTTAGTTGG - Intergenic
953572552 3:44082769-44082791 AATCAGACTTGGCAGTTCATTGG - Intergenic
954936291 3:54329994-54330016 AAAGATAGTTAGGAATTCATTGG + Intronic
957703111 3:83743993-83744015 AATGAGACTTAGGAGCCCAGTGG + Intergenic
958569213 3:95858295-95858317 AAGGAAACTTATCAATTCATGGG + Intergenic
959610289 3:108286483-108286505 AATGAGAGTTAGGACTTCAATGG - Intergenic
966783408 3:183604063-183604085 ATGCAGACTTTGGAGTTTATGGG - Intergenic
970219563 4:13796886-13796908 AAGGAGAATTTGGAGCTCCTGGG - Intergenic
971535105 4:27738301-27738323 AAGGAGAATTAGCAATACATTGG - Intergenic
971582655 4:28362459-28362481 AACAATACTAAGGAGTTCATAGG - Exonic
979101479 4:116621205-116621227 AAGGACACTTAGCAATTCGTGGG - Intergenic
979596120 4:122536021-122536043 AAGGAGAAGTTGGAGGTCATGGG - Intergenic
981257739 4:142683093-142683115 AAGGAGACTTAGGAGTTCATGGG - Intronic
982124294 4:152171154-152171176 GAGGACACTTGGGAGTTGATGGG - Intergenic
983187906 4:164721744-164721766 AAGGAGAGTTAGTGTTTCATGGG - Intergenic
983283475 4:165710057-165710079 AAGGAAACTTAAGACTTCACTGG + Intergenic
987178064 5:15337220-15337242 AAGGAGACATAGGGCTTAATGGG + Intergenic
990111507 5:52331262-52331284 GTGGAGACTTAGGAGAACATAGG - Intergenic
990520968 5:56580501-56580523 AGGGAGACTTAGGAGATACTAGG + Intronic
990763381 5:59155423-59155445 GAAGACAATTAGGAGTTCATTGG + Intronic
993492755 5:88571847-88571869 AAGGACACTTATGATTACATTGG + Intergenic
994263624 5:97688564-97688586 CAGGAGAATTAGGAAATCATAGG + Intergenic
998702774 5:144723348-144723370 TAGCACACTGAGGAGTTCATAGG - Intergenic
999432214 5:151534358-151534380 AAGGTGACCCAGGAGATCATTGG + Intronic
1001125743 5:169017798-169017820 AAGAAGACTTAGGAGATGCTTGG - Intronic
1004753831 6:18590105-18590127 AGAGATATTTAGGAGTTCATGGG - Intergenic
1006487672 6:34357244-34357266 AAGCTGACTGAGGAGTACATGGG + Intronic
1006710745 6:36068046-36068068 AAGGGGAATTAGGAGTACAAGGG + Intronic
1006783341 6:36647785-36647807 AAGGAGGCTCAGGAGTTACTTGG + Intergenic
1009390759 6:63140523-63140545 AAGCTGACTTAAGAGTTTATGGG + Intergenic
1010791761 6:80073470-80073492 TAGGAGATCTAGGAGTTCAAAGG - Intergenic
1011181160 6:84622430-84622452 AAGGAGAATGAGGAGTTTGTGGG - Intergenic
1011892564 6:92184162-92184184 AATGAGAATAAGCAGTTCATGGG + Intergenic
1013109384 6:107052931-107052953 AAGGATTCTCAGGAGTTCCTGGG - Intergenic
1014500806 6:122186572-122186594 AAGGTGACTTAGGAATTTGTAGG + Intergenic
1014580171 6:123127247-123127269 AAGGAGACTCAGTAGTTTCTGGG + Intergenic
1014707148 6:124761584-124761606 AAGGAGAATTAGGAGCTATTTGG - Intronic
1017330494 6:153192859-153192881 ATGGAGACTTAGAATTTAATTGG + Intergenic
1020838166 7:13181124-13181146 AAGGAGACTTGGGAGCACACTGG - Intergenic
1023465588 7:40450791-40450813 AATGAGATTCAGGATTTCATAGG - Intronic
1024053209 7:45642567-45642589 CAGGAGACTTAGTAGTTTCTTGG + Intronic
1025526445 7:61818595-61818617 AAGGACATTTTGGAGCTCATTGG + Intergenic
1025530997 7:61883348-61883370 ATGGAGATTTGGGAGCTCATTGG - Intergenic
1025535297 7:61940212-61940234 AGGGAAACTTGGGAGCTCATTGG + Intergenic
1025549822 7:62231152-62231174 AAGGACATTTTGGAGCTCATTGG + Intergenic
1029506897 7:100968240-100968262 AAGGCGACTGAGGATTTCAAGGG - Exonic
1031054686 7:116980405-116980427 AAGGAGACTAAGGAGCCAATAGG - Intronic
1033005031 7:137552237-137552259 CAGGAGACTCAGTAGTTCCTTGG - Intronic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1035636572 8:1151354-1151376 CAGGAGACTCAGGGGCTCATAGG + Intergenic
1036615587 8:10385093-10385115 AAGGACAAGTGGGAGTTCATAGG + Intronic
1037425966 8:18754988-18755010 CAGGAGACTGAGGAGCTCCTTGG - Intronic
1038522686 8:28246971-28246993 TAGGAGCCTTCTGAGTTCATGGG + Intergenic
1038713462 8:29970888-29970910 AATGAGACTTTGGGGTTCTTGGG - Intergenic
1038903267 8:31868249-31868271 AAGGAATCTTAGGAGTTCCTGGG - Intronic
1039372406 8:36999500-36999522 AAGGAGAGTTATATGTTCATTGG - Intergenic
1040131021 8:43796773-43796795 AGGGACACTTAGGAGCCCATAGG + Intergenic
1041799340 8:61782083-61782105 AAGGAAACTTTGGAGGTGATAGG - Intergenic
1042612982 8:70618286-70618308 TAGGAGCCTAAGGTGTTCATTGG + Intronic
1042613336 8:70621741-70621763 AAGGAAACATAGAAGTTCACAGG + Intronic
1043829101 8:84966331-84966353 AAGGAAATTAAGGAATTCATAGG + Intergenic
1044133026 8:88549891-88549913 AAAGAGACTTAGGAGTTGAAAGG - Intergenic
1045574129 8:103400260-103400282 CAGGAGACTTAGCAGTTCTCTGG + Exonic
1047678870 8:127233192-127233214 AAAGTGACTGAGAAGTTCATAGG + Intergenic
1047888062 8:129274845-129274867 AAGGAGAATTGGCAGTTGATTGG + Intergenic
1049107244 8:140622123-140622145 AAGGAGACACAAGAGTTCACTGG + Intronic
1050327113 9:4508482-4508504 ATGGAGTCTTAGGAGTCCTTTGG - Intronic
1050723163 9:8614355-8614377 AATGAGACTAATGAGTTCAGAGG + Intronic
1052900993 9:33794970-33794992 AGGGAGACTTAGCATTCCATAGG - Intronic
1053576112 9:39358282-39358304 GAGGAGACTGAGGTGGTCATTGG - Exonic
1053840629 9:42186219-42186241 GAGGAGACTGAGGTGGTCATTGG - Exonic
1054097685 9:60916973-60916995 GAGGAGACTGAGGTGGTCATTGG - Intergenic
1054119087 9:61192603-61192625 GAGGAGACTGAGGTGGTCATTGG - Exonic
1054588666 9:66989959-66989981 GAGGAGACTGAGGTGGTCATTGG + Intergenic
1054736994 9:68763812-68763834 AAGGAGATTTACCAATTCATAGG - Intronic
1055439348 9:76323267-76323289 AAGGAGACTAAGGAGTGCAGAGG + Exonic
1055986688 9:82061124-82061146 GAGGAGACTGAGGTGGTCATTGG + Intergenic
1056584713 9:87920460-87920482 GAGGAGACTGAGGTGGTCATTGG - Intergenic
1056612161 9:88132480-88132502 GAGGAGACTGAGGTGGTCATTGG + Intergenic
1056709567 9:88979931-88979953 AAGGAGACTAGGGAGATCTTTGG - Intergenic
1057160488 9:92885090-92885112 GAGGAGACTGAGGTGGTCATTGG - Intergenic
1059616218 9:115954091-115954113 AAGGATACTGAGGAATACATTGG - Intergenic
1060820029 9:126656128-126656150 CAGGAGGCTGATGAGTTCATTGG + Intronic
1062337068 9:136076144-136076166 TAGGAGACTTAGGATGTCACGGG - Intronic
1185749322 X:2598077-2598099 TAGGAGATGTAGGAATTCATAGG - Intergenic
1186983529 X:14985222-14985244 CAGGAGTCTGAGAAGTTCATTGG + Intergenic
1188964982 X:36539826-36539848 AAGTAGACTTTGGAGTTGTTTGG + Intergenic
1191268229 X:58425942-58425964 AAGGAAATTTGGGAGTTCATTGG - Intergenic
1192613559 X:72593046-72593068 AAGGAGACTGAGAATTTCAAGGG + Intronic
1192939761 X:75900511-75900533 AAGGAGATTTAAGAGTGCTTGGG + Intergenic
1193808554 X:86023426-86023448 AAGGACAGGTAGGATTTCATCGG - Intronic
1193832185 X:86302814-86302836 AAAGATTCTTAGGAATTCATTGG + Intronic
1195318106 X:103698374-103698396 AAGGAGTCCTAGGGTTTCATGGG - Intergenic
1195380995 X:104270615-104270637 AAGGAGACTGGGGGGATCATAGG - Intergenic
1195829864 X:109045118-109045140 AAGGAAACTTAGGAGCCCAGAGG - Intergenic
1196285463 X:113873676-113873698 AAGGAAACTGAGGAGTGCAAAGG + Intergenic
1196908630 X:120464109-120464131 ATGGAGAATTAGGAGTTCCTTGG - Intronic
1199735831 X:150685930-150685952 AAGGAGACATACTAGATCATTGG - Intergenic