ID: 981257771

View in Genome Browser
Species Human (GRCh38)
Location 4:142683406-142683428
Sequence CAGACAGGTTTCCATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 232}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981257771 Original CRISPR CAGACAGGTTTCCATGTGGA GGG Intronic
900783776 1:4634611-4634633 CAGACAGGGTTCCCAGTGGGAGG - Intergenic
901381946 1:8879985-8880007 CAGACAGGTTTCCATGGCGTTGG + Intergenic
902471835 1:16653125-16653147 CAGACAGGTCACTATGTGTATGG - Intergenic
902486970 1:16754319-16754341 CAGACAGGTCACTATGTGTATGG + Intronic
902607224 1:17575445-17575467 GAGAGAGAATTCCATGTGGAGGG + Intronic
903259467 1:22123514-22123536 CAGACAGCTTACCATGTGCTGGG + Intronic
909319545 1:74266101-74266123 CAGACAGGATGCCGTGTGGATGG + Intronic
912132508 1:106619850-106619872 CAGACAGGTTACTGGGTGGAAGG + Intergenic
913974658 1:143445650-143445672 CAGGCAGGTGGCCTTGTGGACGG + Intergenic
914069049 1:144271266-144271288 CAGGCAGGTGGCCTTGTGGATGG + Intergenic
914110106 1:144695088-144695110 CAGGCAGGTGGCCTTGTGGATGG - Intergenic
916000188 1:160607884-160607906 AACACAGTTCTCCATGTGGAGGG + Intergenic
916812215 1:168315431-168315453 CAGACAGCTTTCCAAATGCATGG - Intergenic
917131926 1:171751824-171751846 CAGAGGGGATTCCATGTGAAGGG + Intergenic
917674236 1:177304144-177304166 CAGGCAGGGTTCTATGTGCAAGG + Intergenic
918772694 1:188583141-188583163 CAGACAGTTTCCAGTGTGGAAGG - Intergenic
919612082 1:199758031-199758053 CAAACTTGCTTCCATGTGGAGGG - Intergenic
923743295 1:236676033-236676055 CAGACAAATGTCCATGTGTAGGG - Intergenic
923889029 1:238190604-238190626 CAGGCATGATTTCATGTGGATGG + Intergenic
924173231 1:241363026-241363048 GCGTCAGGTTTCCCTGTGGATGG + Intergenic
924812829 1:247418219-247418241 AAGAAAGGTTTCCCTATGGAGGG - Exonic
1063141214 10:3258005-3258027 CAGACACATTTCCAGGTGGAGGG + Intergenic
1063467479 10:6256527-6256549 CAGCCAGGCTGCCATGTGCATGG + Intergenic
1063473993 10:6312187-6312209 CGGACAGGCTTCTGTGTGGAGGG + Intergenic
1065720095 10:28619922-28619944 CAGACAGGTTTACATGTAAAAGG - Exonic
1067099402 10:43323478-43323500 CAGACAGGTTTTCAGGCAGAGGG - Intergenic
1068726751 10:60311729-60311751 AAGACAGCATTCCAGGTGGAGGG - Intronic
1072554638 10:96505411-96505433 CAGCAAGGTTTCCAAGTGGCAGG - Intronic
1075007773 10:118842787-118842809 CAGACAGGTTCCTGGGTGGATGG + Intergenic
1075296337 10:121278986-121279008 CAGAGAAGTTTTAATGTGGATGG - Intergenic
1076674638 10:132141700-132141722 GAGAAAGGTTTCCCTGGGGAGGG - Intronic
1077848047 11:6046574-6046596 CAGAGAGGCCTCCAGGTGGATGG + Intergenic
1081268553 11:41057437-41057459 CAGACAGGTTCCTGGGTGGAAGG + Intronic
1081537169 11:44004506-44004528 CAGACAGGCTTTTATGGGGAGGG - Intergenic
1082010034 11:47443595-47443617 CAGACATGTTTGCACGTGGATGG - Intronic
1082902272 11:58267721-58267743 TAGACAGGTTTCTGTGTGAATGG + Exonic
1083066820 11:59932193-59932215 CAGACAGAGTTCCAAGTGGAAGG - Intergenic
1086018677 11:82199100-82199122 GAGAGAGGTTTGTATGTGGAAGG + Intergenic
1088978369 11:114836458-114836480 CAGCCATGTTTCTCTGTGGAAGG - Intergenic
1089790899 11:120942701-120942723 CATACAGGTTTTCAGGTGGTAGG - Intronic
1092502958 12:9065644-9065666 CAGACAGGTTCCTGGGTGGAAGG + Intergenic
1094393385 12:29977855-29977877 CAGTCAGGTTTCTATGTGATAGG + Intergenic
1094537105 12:31331378-31331400 CAAACATGTTTTCATGTGGTTGG - Intergenic
1096759401 12:53827515-53827537 CAGACAGGTTCCCTAGTGGGTGG + Intergenic
1097468864 12:59963431-59963453 AAGACAGGTTTTCATGTTCAAGG - Intergenic
1100847879 12:98678974-98678996 CAGACAGGTTCCTGGGTGGAAGG + Intronic
1102588436 12:113939789-113939811 CAGACAGGTTTTCAGGCGGCAGG + Intronic
1103736180 12:123062183-123062205 CAGACAGGCAGCCAGGTGGAAGG + Intronic
1103767924 12:123295881-123295903 CAGACAGGTTTCAACATGGATGG - Exonic
1105041840 12:132967055-132967077 CAGACAGGTTCCTGGGTGGAAGG + Intergenic
1105958773 13:25309756-25309778 CAGCCAGCTTTCAATCTGGATGG + Intronic
1110319640 13:74147198-74147220 CAGACATTGTTCCTTGTGGATGG + Intergenic
1111602626 13:90494212-90494234 CAGGCTGGTTTCCAGGTGTAGGG + Intergenic
1113461149 13:110483036-110483058 GACACAGCTTTCCAGGTGGAAGG + Intronic
1115137991 14:30134146-30134168 CTGAGGGCTTTCCATGTGGAAGG + Intronic
1118116097 14:62778426-62778448 CAAACAGGTTGCCTTGTTGAAGG + Intronic
1119050454 14:71362925-71362947 CAGACAGATTTCCATCTGTTTGG + Intronic
1119948779 14:78722990-78723012 CAGTAAGTTTTCCATGTGGGTGG + Intronic
1120870847 14:89336254-89336276 CAGAGAGGATTCTGTGTGGATGG - Intronic
1121214947 14:92240504-92240526 CAGACATGTATCCATGGGGCAGG + Intergenic
1124692045 15:31831940-31831962 CAGACAGGTTGCCTGGCGGAAGG + Intronic
1124953753 15:34346366-34346388 CAGAGAGGTTTCAAGGGGGAAGG + Intronic
1125007707 15:34836897-34836919 CAGAGATGTTTACGTGTGGAGGG - Intergenic
1125718083 15:41830960-41830982 CAGACAGGTTCCTGGGTGGAAGG + Intronic
1126292639 15:47099564-47099586 CAGACAGGTTCCTGGGTGGAAGG - Intergenic
1128068571 15:64779354-64779376 CAGAAAGCTTCCCATGTGGTAGG - Intergenic
1130234011 15:82117696-82117718 CACTCAGCTTTCCATATGGAAGG + Intergenic
1132170398 15:99646349-99646371 CATACTGGTTTCCATTTTGAAGG - Intronic
1132262540 15:100439431-100439453 CTGAGAGTTTTCCATGTGTAAGG + Intronic
1133147768 16:3802840-3802862 GAGTCAGGTTTCCAGGTGGGTGG - Intronic
1133767156 16:8846074-8846096 CTGACAGGTTCCCAAGTGGCTGG + Intronic
1135510599 16:23079880-23079902 CAGACGGGTTTGCTTGTGGCAGG - Intronic
1135664325 16:24323268-24323290 CAGAAAGATGTCCATATGGAAGG - Intronic
1136103076 16:28009667-28009689 CAAACAGGCTTCCATGAGGCAGG + Intronic
1138328503 16:56193710-56193732 CAGGCAGGTTTGCTTGGGGAGGG + Intronic
1138813618 16:60178894-60178916 CAGCCATATTTCCATGTGGGAGG - Intergenic
1138878281 16:60979413-60979435 CAGACAGGTTCCTGGGTGGAAGG + Intergenic
1138985766 16:62326887-62326909 CAGACCTGTTTCCAGGAGGATGG - Intergenic
1141310864 16:82912094-82912116 CCCACAGGTTTCCATGGTGATGG - Intronic
1141567216 16:84910836-84910858 CTGGCAGGTTTGCATGTGTATGG + Intronic
1142287029 16:89175654-89175676 CAGGCAGGTTTCCACTTGGCAGG + Intronic
1146093469 17:29905655-29905677 CAGACAGAGTGCCAGGTGGAAGG + Intronic
1146795712 17:35779155-35779177 CAGCCAGGCTTCCAGGAGGAGGG + Intronic
1149362523 17:55910622-55910644 CAGACAGGCTTCTAGATGGAAGG - Intergenic
1151559979 17:74864780-74864802 GAGCCAGGGTTCCAGGTGGAGGG - Intronic
1151697202 17:75723726-75723748 GAGACAGGATTCAATGGGGAGGG + Intronic
1156160335 18:34351082-34351104 CAGACAGGATCCTGTGTGGAAGG + Intergenic
1157774108 18:50377674-50377696 CAGACAGAATTCCATGTGCTGGG + Intronic
1157946752 18:51989129-51989151 CAGACAGGTTTCTTTGGTGAAGG - Intergenic
1158851681 18:61501080-61501102 CAGACAGGTTTTGATGAGGGAGG + Intronic
1160451833 18:78971700-78971722 CAGACCGGCTTGGATGTGGAAGG - Intergenic
1161781785 19:6297829-6297851 CAGACAGGTTCCTGGGTGGAAGG + Intergenic
1161876645 19:6916499-6916521 CAGAGAGTTTTCCATGTGCTAGG + Intronic
1162057489 19:8073367-8073389 CATACAGCATTCCAGGTGGAGGG - Intronic
1163249182 19:16116096-16116118 CAGAAAGGTTCCCCTGAGGAGGG + Intronic
1164037217 19:21465840-21465862 CAGGCAGGTTTTCTTGTAGACGG + Intronic
1164288005 19:23839473-23839495 CAAATCTGTTTCCATGTGGAGGG + Intergenic
1165066846 19:33234520-33234542 GAGACAGGTTTGCAAGTGAAAGG + Intergenic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1166050812 19:40257832-40257854 GAGACATGCTGCCATGTGGAGGG + Intronic
1168594589 19:57664941-57664963 CAGGCCGGTCTCCATGAGGAGGG - Intergenic
1202704235 1_KI270713v1_random:9919-9941 CAGACAGGTCACTATGTGTATGG - Intergenic
925840695 2:7989341-7989363 CAGACAGGGTTCCAAGTTGAGGG - Intergenic
926388507 2:12362679-12362701 CTTAGAGGTTTTCATGTGGAGGG - Intergenic
926493878 2:13559558-13559580 GAGACAGGCTTCCATGAGTAAGG + Intergenic
926859308 2:17291888-17291910 CAGACAGGTTTCTGTGTGGAAGG - Intergenic
927683319 2:25154404-25154426 CAGCCAGATCTCCATGTGGTCGG - Exonic
928848284 2:35707699-35707721 CAGAAAGTTTTCTATGAGGAGGG + Intergenic
931873802 2:66490394-66490416 CAAACAGGTATCCATGTCAAAGG - Intronic
932491707 2:72127002-72127024 CAGAAAGGTTTCCATGTGAGAGG - Intergenic
932526794 2:72478377-72478399 CATAAAGGTTTCCATCTGCAAGG + Intronic
933043835 2:77508122-77508144 CAGACAGGTCCCCTTGAGGAAGG + Intronic
933801182 2:85961459-85961481 CAGACAGGTTCCTGGGTGGAAGG - Intergenic
933978104 2:87528083-87528105 CAGGCAGGACTCCATGGGGATGG + Intergenic
934165331 2:89289016-89289038 CATACATGTGGCCATGTGGAAGG + Intergenic
934179362 2:89606625-89606647 CAGGCAGGTGGCCTTGTGGACGG + Intergenic
934201943 2:89893446-89893468 CATACATGTGGCCATGTGGAAGG - Intergenic
934289648 2:91680888-91680910 CAGGCAGGTGGCCTTGTGGACGG + Intergenic
935135457 2:100296565-100296587 CTGCCAGGTTTCCTTGTGGTTGG + Intronic
937440752 2:121913404-121913426 AAGACAGGTTCCCTTGAGGAGGG + Intergenic
938038120 2:128053391-128053413 CAAGCCTGTTTCCATGTGGAGGG + Intergenic
938624254 2:133091296-133091318 AGGAAAGGTTTCCATGGGGAAGG - Intronic
940875492 2:158893429-158893451 GTGACAGGATTCCTTGTGGAAGG - Intergenic
940968434 2:159866993-159867015 CAGAGATGTTTCTAAGTGGAAGG - Intronic
942791909 2:179770123-179770145 CAGAAAGGGTTTCATGAGGAAGG - Intronic
943747552 2:191477994-191478016 AAGAGAGGTCTCCAAGTGGAAGG - Intergenic
944259154 2:197657263-197657285 CAGACAGGTCTCCTTTGGGATGG - Intronic
946329021 2:218999502-218999524 CAGACAGGTTTGGAGGTGGGGGG - Intergenic
948336017 2:237207602-237207624 CAGACAGCTCTCCAGGTGCAAGG - Intergenic
1169324341 20:4663159-4663181 CAGACAGCTTCCCATGGTGAGGG + Intergenic
1171268788 20:23797232-23797254 TAGACAGTGTTCCATGTGCATGG - Intergenic
1172637299 20:36418585-36418607 CAGGCAGGTTTCAATGGGGGTGG + Intronic
1173153412 20:40587164-40587186 CAGACAAGCTTCCCTGTGGACGG + Intergenic
1173726097 20:45298960-45298982 CCGACAGCTTACCATGTGGTAGG + Intronic
1174403663 20:50290086-50290108 AAGACTGTTTTCCAGGTGGAGGG + Intergenic
1176218610 20:63959615-63959637 CAGACACATTCCCATGAGGAGGG + Exonic
1176408377 21:6434212-6434234 CAGACAGGTTCCTGGGTGGAAGG + Intergenic
1177672661 21:24253194-24253216 CAGACATTTTTGCTTGTGGAGGG + Intergenic
1178516988 21:33256470-33256492 CAGACAGGTTTGGATGGTGAGGG + Intronic
1178798511 21:35768351-35768373 CAGACAGGTTTCCAAGGCCAAGG + Intronic
1179134851 21:38670323-38670345 CAAACTGGCTTCCAGGTGGAAGG + Intergenic
1179158973 21:38876323-38876345 CAGATAGGTTTCCTTGTTGCAGG + Intergenic
1182826429 22:33268850-33268872 CAGAAATGTATACATGTGGATGG + Intronic
1183048489 22:35241291-35241313 CAAATATGTTTCCAGGTGGAGGG + Intergenic
1184243993 22:43226780-43226802 CAGACAGGGTCCCATGTACAGGG + Intronic
1184373774 22:44099015-44099037 CAGACAGGCTCCCATGGGGCTGG - Intronic
1184870874 22:47237838-47237860 CCCTCATGTTTCCATGTGGAGGG + Intergenic
949616681 3:5761185-5761207 CAGACAGGTAACCAGATGGAAGG + Intergenic
949933773 3:9101005-9101027 CTGACAGGTTTCCATGTGACAGG + Intronic
950887398 3:16373825-16373847 CAGAAAGGTTTGCATTGGGAAGG + Intronic
951119504 3:18908595-18908617 CAGACAGGTCACTATGTGTATGG + Intergenic
951509665 3:23486962-23486984 CAGACAGGTGCCTATGTGGGAGG - Intronic
951595996 3:24318695-24318717 CAGACAGGATTCCCTGTGTATGG + Intronic
953716386 3:45319962-45319984 CAGACAGGCTGCCTTGTGGAAGG + Intergenic
954003127 3:47573317-47573339 AAGATAGGTTTGCATGTGCAGGG - Intronic
954473289 3:50718600-50718622 CAGAAAGGTTTTCTTGTGGGAGG - Intronic
955262402 3:57406512-57406534 GAGACAGGTTTCCACTTGGATGG - Intronic
955303788 3:57809559-57809581 CAGACAGGTTCCCGGGTGGAAGG + Intronic
958263021 3:91404337-91404359 CAGATCTGTTTCCAGGTGGAAGG + Intergenic
959540196 3:107527947-107527969 CAAACACATTTCCATGGGGAAGG - Intronic
960637364 3:119796662-119796684 AAGACAAGTTTGAATGTGGAGGG - Intronic
963380150 3:144519519-144519541 AAAACAGCTTTCCATGTGAATGG - Intergenic
963665227 3:148176370-148176392 AAGACAGGTAGCCATCTGGAAGG - Intergenic
965005613 3:163019063-163019085 CAGACAGGCTTCTGAGTGGAAGG + Intergenic
965272704 3:166638807-166638829 CAGACAGGTTCCTGGGTGGAAGG + Intergenic
968002369 3:195214732-195214754 CAGACATGTTTCTAAGGGGAGGG - Intronic
969358105 4:6643095-6643117 CAGAAAGGCTTCAATCTGGAAGG - Intergenic
970660780 4:18283190-18283212 CAGAAAGGATCCCATGTGGGAGG + Intergenic
971424359 4:26501529-26501551 AAGACAGATTTCCCTGAGGAAGG - Intergenic
971714131 4:30153576-30153598 CAGACAGGCTCCTAGGTGGAAGG - Intergenic
972622009 4:40756341-40756363 TTTACATGTTTCCATGTGGAGGG - Intronic
975321293 4:73012037-73012059 CAGACAGGGTTCTGGGTGGAGGG + Intergenic
975644876 4:76536228-76536250 CTGACAAGTATCCATGTGCAGGG + Intronic
975913645 4:79297804-79297826 CAGACAGGCTTCTGTGTGGAAGG + Intronic
979425814 4:120564373-120564395 CAGACACCTTTCCATGTAGCTGG - Intergenic
980857987 4:138463634-138463656 AAGACAGGGTTCCATGTACAAGG + Intergenic
981257771 4:142683406-142683428 CAGACAGGTTTCCATGTGGAGGG + Intronic
981500105 4:145440912-145440934 CAGAAAGGTGTCCATGCAGAAGG + Intergenic
982531129 4:156545433-156545455 CAGACATGTTTTCATTTTGATGG - Intergenic
984102139 4:175499419-175499441 CAGACAGGCTTCTGGGTGGAAGG - Intergenic
984132789 4:175898965-175898987 CAGACAAGTTTCCATGCTCATGG + Intronic
985181603 4:187271176-187271198 TGGACTGGTTTCCATGGGGAAGG - Intergenic
985793464 5:1945365-1945387 GAGCCAGGTTTGCCTGTGGATGG + Intergenic
986089108 5:4485825-4485847 CAAACAGGTTTTCATGTGCAAGG + Intergenic
986091406 5:4512136-4512158 CAGGAAGTTTTGCATGTGGAGGG - Intergenic
986092069 5:4519437-4519459 CAGTCAGGGCTCCAGGTGGAGGG - Intergenic
986954964 5:13139453-13139475 CAGGTAGGTTTCCAACTGGATGG - Intergenic
988073782 5:26326167-26326189 CAGACAGGCTCCTAGGTGGAAGG - Intergenic
989279213 5:39621974-39621996 TAGACAGGCTTCCGGGTGGAAGG - Intergenic
989333893 5:40291737-40291759 TAGACAGGTCACCATGTAGATGG - Intergenic
989637646 5:43554010-43554032 CACACAGGTTTCCAGGTGCCAGG + Intronic
990512706 5:56503223-56503245 CAGACAGGTCCACATATGGAAGG + Intergenic
991589358 5:68233277-68233299 CTAACAGATTTCCATGGGGAAGG + Intronic
994377771 5:99034622-99034644 CAAGCAGGTTTCCAGTTGGAGGG + Intergenic
995631566 5:114139129-114139151 CAGAGAGGTTGCCATGTAAATGG - Intergenic
997694265 5:135849271-135849293 CACACTGGGTTCCATGGGGATGG + Intronic
998449511 5:142223298-142223320 CAGACAGGACTTCATGTGGGAGG - Intergenic
999197696 5:149793651-149793673 CAGACAGCTTTCCAAGCGTAAGG - Intronic
999507698 5:152215333-152215355 CAGACAGGATTTGAAGTGGAGGG - Intergenic
1000608123 5:163345782-163345804 TAGACAGTTTTCTAGGTGGAGGG + Intergenic
1003285039 6:4726815-4726837 AAGACAAGTCTCCATGTGAAGGG + Intronic
1003968067 6:11272239-11272261 AAGACAGATTTGCAGGTGGAGGG - Intronic
1006893611 6:37451422-37451444 CAGAGAGGCTTCCTGGTGGAAGG + Intronic
1007234373 6:40379709-40379731 GAGCCAAGTTTCCATGTTGATGG - Intergenic
1007706285 6:43793469-43793491 CAGACAGGTTTCCACCTTGAGGG - Intergenic
1008992386 6:57618550-57618572 CAGATCTGTTTCCAGGTGGAAGG - Intronic
1009181009 6:60517663-60517685 CAGATCTGTTTCCAGGTGGAAGG - Intergenic
1009307013 6:62103237-62103259 CAGACAGGTTTCTAGGTGGGAGG - Intronic
1010323370 6:74539005-74539027 GAGGCAGGTCTCCATGAGGAAGG + Intergenic
1011833652 6:91404082-91404104 CTGACAGGGTTCCTTGAGGAGGG + Intergenic
1014841009 6:126220006-126220028 CATACAGGTTAGCAGGTGGAAGG + Intergenic
1015343340 6:132127525-132127547 TAGACAGGTTTCCATGTGCAAGG + Intergenic
1015460144 6:133481089-133481111 GAGTCAGGTTTGCAGGTGGAGGG + Intronic
1018162906 6:161064928-161064950 CAAACAGGTTTCCCTCAGGAAGG + Intronic
1019612171 7:1942099-1942121 CAGACAGGTGTGCGGGTGGATGG - Intronic
1020341704 7:7118163-7118185 CTAAAAGGTTTCCATGTGCACGG - Intergenic
1024004760 7:45217157-45217179 CAGTGAGGGTTCCCTGTGGAGGG + Intergenic
1025849985 7:65237489-65237511 CAGTGAGGTTACCATGGGGAGGG - Intergenic
1027517941 7:79166111-79166133 CAGACATCTTTGCATGTGGTAGG + Intronic
1029354284 7:100039653-100039675 CACACAGTCTTCCATGAGGATGG - Exonic
1029669913 7:102022655-102022677 CAGAGAGGTTTCTATGTGGAAGG - Intronic
1029834599 7:103296263-103296285 CAGACAGGTCTTGAAGTGGAGGG + Intergenic
1034838617 7:154375123-154375145 CAGACAGTTCTGGATGTGGAGGG + Intronic
1035361416 7:158316125-158316147 CAGGCAGCTTCCCCTGTGGAAGG + Intronic
1035811753 8:2497483-2497505 CAGACAGTTAGCCAGGTGGAAGG + Intergenic
1036059921 8:5305362-5305384 CCAACAGGTTTCCAGTTGGATGG - Intergenic
1039879451 8:41615365-41615387 CAGCCAGCTTTCCATGTGGAGGG - Intronic
1041770147 8:61464595-61464617 CAGAGAAGCCTCCATGTGGAAGG + Intronic
1043734257 8:83724267-83724289 CAGACAGGCTCCTAGGTGGAAGG - Intergenic
1043986278 8:86696136-86696158 CAGTCAAGTTGTCATGTGGATGG + Intronic
1047955765 8:129974070-129974092 CAGACAGGCTGCCCTGTGGGTGG - Intronic
1048960297 8:139571112-139571134 CAGACAGGTATGCATGTATATGG - Intergenic
1049043304 8:140129229-140129251 CAGGCAGGTATCCGTGAGGAGGG + Intronic
1049246092 8:141563328-141563350 CAGGCACGTTTCCCTGTGGGAGG - Intergenic
1051059840 9:13033106-13033128 CAGACAGGGTTTCATGAGGCTGG + Intergenic
1052014499 9:23449189-23449211 CAGAATAGTTTCCAAGTGGATGG + Intergenic
1052437125 9:28443813-28443835 CAGACAGGTTCCTAGGTGGGAGG + Intronic
1053171810 9:35892412-35892434 CAGACAGGTTTCCTGCTGGGAGG + Intergenic
1058510737 9:105713641-105713663 CAGACAGGCTTCTTGGTGGAAGG + Intronic
1059639252 9:116200438-116200460 CTGACACTTTTCCAAGTGGAGGG + Intronic
1059950815 9:119460808-119460830 CGGATAGGTTTCCAGGAGGATGG + Intergenic
1062007641 9:134249240-134249262 CAGAGAGGATTCCACGTGCATGG + Intergenic
1185578646 X:1193417-1193439 GACACATGTGTCCATGTGGAAGG - Intronic
1186484765 X:9925543-9925565 GAGCCAGGTTTCCATGAGCATGG - Intronic
1189083562 X:37997721-37997743 CAGACAGGTTCCTAGGTGGAAGG + Intronic
1192207678 X:69107055-69107077 CAGACAGGATTCCAGAAGGAAGG - Intergenic
1195179100 X:102339564-102339586 CAGACAGGTTTCTAGGCAGAAGG - Intergenic
1195282104 X:103346382-103346404 CAGACATGATTCCATTTGGTTGG - Intergenic
1195869525 X:109471550-109471572 CAGCTAGGTTTCCTTGTGCAGGG + Intronic
1196500214 X:116372195-116372217 CAGATAGGTTTCCTTGTGGGAGG + Intergenic
1196537800 X:116868122-116868144 CAGACAAGTTCCCAGGAGGAGGG - Intergenic
1197872070 X:131070168-131070190 CAGACAGGCTTAGAGGTGGAGGG - Intronic
1199188016 X:144939491-144939513 CAGACAGGCTTCTGGGTGGAAGG - Intergenic
1199503026 X:148530050-148530072 CAGACAGGTTAATATGTGAAGGG + Intronic
1199545630 X:149005117-149005139 CTGACAGGTTTGCATGTGGAGGG - Intergenic
1199769298 X:150964045-150964067 CATACAACTTTCCAAGTGGAAGG - Intergenic
1199863715 X:151824452-151824474 AAGCCATGTTTGCATGTGGATGG + Intergenic
1201482787 Y:14457989-14458011 CAGGCAAGTTTGCATGTGCAGGG - Intergenic
1201935439 Y:19406685-19406707 CAGACAGGTTCCTGGGTGGAAGG - Intergenic