ID: 981260737

View in Genome Browser
Species Human (GRCh38)
Location 4:142715719-142715741
Sequence AAATGTTGGGATAATTTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 1, 2: 8, 3: 46, 4: 359}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981260737_981260741 26 Left 981260737 4:142715719-142715741 CCTAACAAATTATCCCAACATTT 0: 1
1: 1
2: 8
3: 46
4: 359
Right 981260741 4:142715768-142715790 TTGTTAACCATCTGCATTTTAGG 0: 1
1: 0
2: 0
3: 25
4: 220
981260737_981260742 30 Left 981260737 4:142715719-142715741 CCTAACAAATTATCCCAACATTT 0: 1
1: 1
2: 8
3: 46
4: 359
Right 981260742 4:142715772-142715794 TAACCATCTGCATTTTAGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981260737 Original CRISPR AAATGTTGGGATAATTTGTT AGG (reversed) Intronic