ID: 981260739

View in Genome Browser
Species Human (GRCh38)
Location 4:142715732-142715754
Sequence ATTTGAAGCCACTAAATGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1562
Summary {0: 1, 1: 2, 2: 40, 3: 293, 4: 1226}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981260739_981260743 18 Left 981260739 4:142715732-142715754 CCCAACATTTAGTGGCTTCAAAT 0: 1
1: 2
2: 40
3: 293
4: 1226
Right 981260743 4:142715773-142715795 AACCATCTGCATTTTAGGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 181
981260739_981260742 17 Left 981260739 4:142715732-142715754 CCCAACATTTAGTGGCTTCAAAT 0: 1
1: 2
2: 40
3: 293
4: 1226
Right 981260742 4:142715772-142715794 TAACCATCTGCATTTTAGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 152
981260739_981260745 25 Left 981260739 4:142715732-142715754 CCCAACATTTAGTGGCTTCAAAT 0: 1
1: 2
2: 40
3: 293
4: 1226
Right 981260745 4:142715780-142715802 TGCATTTTAGGCTGGGACCATGG 0: 1
1: 0
2: 3
3: 6
4: 150
981260739_981260747 27 Left 981260739 4:142715732-142715754 CCCAACATTTAGTGGCTTCAAAT 0: 1
1: 2
2: 40
3: 293
4: 1226
Right 981260747 4:142715782-142715804 CATTTTAGGCTGGGACCATGGGG No data
981260739_981260741 13 Left 981260739 4:142715732-142715754 CCCAACATTTAGTGGCTTCAAAT 0: 1
1: 2
2: 40
3: 293
4: 1226
Right 981260741 4:142715768-142715790 TTGTTAACCATCTGCATTTTAGG 0: 1
1: 0
2: 0
3: 25
4: 220
981260739_981260746 26 Left 981260739 4:142715732-142715754 CCCAACATTTAGTGGCTTCAAAT 0: 1
1: 2
2: 40
3: 293
4: 1226
Right 981260746 4:142715781-142715803 GCATTTTAGGCTGGGACCATGGG 0: 1
1: 0
2: 0
3: 18
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981260739 Original CRISPR ATTTGAAGCCACTAAATGTT GGG (reversed) Intronic