ID: 981260740

View in Genome Browser
Species Human (GRCh38)
Location 4:142715733-142715755
Sequence TATTTGAAGCCACTAAATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1434
Summary {0: 1, 1: 8, 2: 68, 3: 285, 4: 1072}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981260740_981260745 24 Left 981260740 4:142715733-142715755 CCAACATTTAGTGGCTTCAAATA 0: 1
1: 8
2: 68
3: 285
4: 1072
Right 981260745 4:142715780-142715802 TGCATTTTAGGCTGGGACCATGG 0: 1
1: 0
2: 3
3: 6
4: 150
981260740_981260742 16 Left 981260740 4:142715733-142715755 CCAACATTTAGTGGCTTCAAATA 0: 1
1: 8
2: 68
3: 285
4: 1072
Right 981260742 4:142715772-142715794 TAACCATCTGCATTTTAGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 152
981260740_981260747 26 Left 981260740 4:142715733-142715755 CCAACATTTAGTGGCTTCAAATA 0: 1
1: 8
2: 68
3: 285
4: 1072
Right 981260747 4:142715782-142715804 CATTTTAGGCTGGGACCATGGGG No data
981260740_981260746 25 Left 981260740 4:142715733-142715755 CCAACATTTAGTGGCTTCAAATA 0: 1
1: 8
2: 68
3: 285
4: 1072
Right 981260746 4:142715781-142715803 GCATTTTAGGCTGGGACCATGGG 0: 1
1: 0
2: 0
3: 18
4: 530
981260740_981260741 12 Left 981260740 4:142715733-142715755 CCAACATTTAGTGGCTTCAAATA 0: 1
1: 8
2: 68
3: 285
4: 1072
Right 981260741 4:142715768-142715790 TTGTTAACCATCTGCATTTTAGG 0: 1
1: 0
2: 0
3: 25
4: 220
981260740_981260743 17 Left 981260740 4:142715733-142715755 CCAACATTTAGTGGCTTCAAATA 0: 1
1: 8
2: 68
3: 285
4: 1072
Right 981260743 4:142715773-142715795 AACCATCTGCATTTTAGGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981260740 Original CRISPR TATTTGAAGCCACTAAATGT TGG (reversed) Intronic