ID: 981260742

View in Genome Browser
Species Human (GRCh38)
Location 4:142715772-142715794
Sequence TAACCATCTGCATTTTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981260739_981260742 17 Left 981260739 4:142715732-142715754 CCCAACATTTAGTGGCTTCAAAT 0: 1
1: 2
2: 40
3: 293
4: 1226
Right 981260742 4:142715772-142715794 TAACCATCTGCATTTTAGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 152
981260740_981260742 16 Left 981260740 4:142715733-142715755 CCAACATTTAGTGGCTTCAAATA 0: 1
1: 8
2: 68
3: 285
4: 1072
Right 981260742 4:142715772-142715794 TAACCATCTGCATTTTAGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 152
981260737_981260742 30 Left 981260737 4:142715719-142715741 CCTAACAAATTATCCCAACATTT 0: 1
1: 1
2: 8
3: 46
4: 359
Right 981260742 4:142715772-142715794 TAACCATCTGCATTTTAGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981260742 Original CRISPR TAACCATCTGCATTTTAGGC TGG Intronic