ID: 981260745

View in Genome Browser
Species Human (GRCh38)
Location 4:142715780-142715802
Sequence TGCATTTTAGGCTGGGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981260739_981260745 25 Left 981260739 4:142715732-142715754 CCCAACATTTAGTGGCTTCAAAT 0: 1
1: 2
2: 40
3: 293
4: 1226
Right 981260745 4:142715780-142715802 TGCATTTTAGGCTGGGACCATGG 0: 1
1: 0
2: 3
3: 6
4: 150
981260740_981260745 24 Left 981260740 4:142715733-142715755 CCAACATTTAGTGGCTTCAAATA 0: 1
1: 8
2: 68
3: 285
4: 1072
Right 981260745 4:142715780-142715802 TGCATTTTAGGCTGGGACCATGG 0: 1
1: 0
2: 3
3: 6
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981260745 Original CRISPR TGCATTTTAGGCTGGGACCA TGG Intronic