ID: 981260747 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:142715782-142715804 |
| Sequence | CATTTTAGGCTGGGACCATG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 981260740_981260747 | 26 | Left | 981260740 | 4:142715733-142715755 | CCAACATTTAGTGGCTTCAAATA | 0: 1 1: 8 2: 68 3: 285 4: 1072 |
||
| Right | 981260747 | 4:142715782-142715804 | CATTTTAGGCTGGGACCATGGGG | No data | ||||
| 981260739_981260747 | 27 | Left | 981260739 | 4:142715732-142715754 | CCCAACATTTAGTGGCTTCAAAT | 0: 1 1: 2 2: 40 3: 293 4: 1226 |
||
| Right | 981260747 | 4:142715782-142715804 | CATTTTAGGCTGGGACCATGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 981260747 | Original CRISPR | CATTTTAGGCTGGGACCATG GGG | Intronic | ||