ID: 981263400

View in Genome Browser
Species Human (GRCh38)
Location 4:142750719-142750741
Sequence CTGATTAGACCCATCTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981263400 Original CRISPR CTGATTAGACCCATCTGCCA AGG (reversed) Intronic
903610747 1:24610294-24610316 CTGATCAGACACTCCTGCCATGG + Intergenic
903687298 1:25141223-25141245 GTGATTAGAACAATCAGCCAGGG + Intergenic
903960529 1:27054397-27054419 CTCATTAGGCCCATCTGCACAGG - Intergenic
904688821 1:32278721-32278743 ATGATTAGTAACATCTGCCATGG + Intronic
905102453 1:35536689-35536711 TTCAAAAGACCCATCTGCCAAGG + Intronic
906108759 1:43309716-43309738 CAGCTTAGACCCATCTGGAAAGG + Intronic
906282236 1:44562348-44562370 CTGCTTAAACCCATGTGTCAGGG + Intronic
910192396 1:84607241-84607263 CTCATTTCACCCATCGGCCAAGG + Intergenic
910856446 1:91700705-91700727 CTGATGGGACCCAGCTCCCAGGG - Intronic
911054813 1:93700608-93700630 CTGTTTGTATCCATCTGCCAAGG - Intronic
917068888 1:171127795-171127817 GTGATTAAATTCATCTGCCAGGG - Intergenic
919448881 1:197746156-197746178 CTGATATGATCCATCTGCCTTGG - Intronic
922063068 1:222110021-222110043 CTGGTTAGATACATCTGCCCTGG + Intergenic
1068366295 10:56054895-56054917 CTGATAAGATCCCTCTTCCAGGG + Intergenic
1069039330 10:63678494-63678516 GTTATTTGACACATCTGCCAGGG - Intergenic
1070432168 10:76351724-76351746 CTGATAAGACCTATCTCACAGGG - Intronic
1070778900 10:79126307-79126329 CTCATCAGCCCCCTCTGCCAAGG + Intronic
1071725153 10:88191049-88191071 CTGCTTAGACCCAGCTGGCTTGG + Intergenic
1072302373 10:94073675-94073697 ATGATTAGTAGCATCTGCCATGG - Intronic
1075794124 10:125106806-125106828 CTGATGAGAACCAGCAGCCAGGG + Intronic
1076514611 10:131036910-131036932 CTGCTGTGACCCATCTCCCATGG + Intergenic
1079682397 11:23314757-23314779 CTGAATAGATCAGTCTGCCAAGG - Intergenic
1081004121 11:37712483-37712505 CTTAACAGACCCATCTGCCATGG + Intergenic
1085431837 11:76458807-76458829 ATGATAAAACCCTTCTGCCAGGG - Intronic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1091909085 12:4214337-4214359 ATTATTATACCCATCTGACAAGG - Intergenic
1099910080 12:88820343-88820365 CTGATTAAAGCCTTCTGCCTTGG - Intergenic
1100461582 12:94804980-94805002 CTGATTAATGCCATCTGTCAGGG - Intergenic
1100567052 12:95806579-95806601 CTGTTCACACCCTTCTGCCATGG + Intronic
1102764298 12:115418495-115418517 CTGATTAGACTCCTCTTTCAGGG - Intergenic
1106135761 13:26972277-26972299 CTGCTGAGAGCCATCTGTCAGGG - Intergenic
1108681761 13:52786814-52786836 CTGCTTATAGTCATCTGCCAAGG + Intergenic
1109115435 13:58376525-58376547 CTGATTGGACCCATGTCCCCTGG + Intergenic
1110771610 13:79354957-79354979 CTGAGTACTCCTATCTGCCACGG + Intronic
1111615546 13:90658236-90658258 CTGATTAGAAGCATCTGCGTTGG + Intergenic
1118444305 14:65837738-65837760 CTGATTAGACAAATCATCCAGGG + Intergenic
1118983560 14:70734468-70734490 CTGCTTATATCCATCTACCAGGG + Exonic
1124034959 15:26046415-26046437 CTGAGTAAACCCATCCTCCAGGG - Intergenic
1124266022 15:28235308-28235330 TGGATTGGACCCACCTGCCAGGG + Intronic
1125428105 15:39569925-39569947 CTGTTTAAACCCATATCCCAAGG + Intergenic
1128795735 15:70465224-70465246 ATGATCAGACCCAGCTTCCAGGG + Intergenic
1129075848 15:72995354-72995376 CTAAATAGACCCTTCTCCCAAGG + Intergenic
1129543050 15:76366895-76366917 CTGTTTTGACACAGCTGCCAAGG - Intronic
1133753311 16:8742073-8742095 CGGAACAGACCCATCTGCCTTGG + Intronic
1135895724 16:26400505-26400527 CTGGTAAGACCAATCTACCATGG + Intergenic
1140868224 16:79082875-79082897 CTTATTATGCACATCTGCCACGG - Intronic
1141273492 16:82562355-82562377 CTGATTTGACTCATAGGCCATGG - Intergenic
1142145838 16:88492625-88492647 CCGGTTAGACCCATTTCCCAGGG + Intronic
1143408814 17:6696383-6696405 CTGACTAGCCCTGTCTGCCAGGG - Intronic
1143853897 17:9834321-9834343 TTGATAAAAGCCATCTGCCATGG + Intronic
1151510557 17:74556713-74556735 CTCATAATACCCATGTGCCATGG + Intergenic
1155152555 18:23134896-23134918 ATGAATAGACCCAACTGCAATGG + Intronic
1155435222 18:25805682-25805704 CTGAAAAGACCCATGTGGCAAGG + Intergenic
1164099480 19:22042027-22042049 GTGATTTGACCCTTCTGCCTAGG - Intergenic
1164119681 19:22254907-22254929 GTGATTTGACCCTTCTGCCTAGG - Intergenic
1164232841 19:23306340-23306362 ATGATTTGACACATCTGCCTGGG + Intronic
939635749 2:144580824-144580846 CGGATTAGAGCCATATGGCATGG + Intergenic
941685285 2:168441651-168441673 CTGAACAGCCCCAGCTGCCAAGG + Intergenic
943344569 2:186723183-186723205 CTGGTTAGATCCATTTGCTAGGG - Intronic
946808609 2:223497834-223497856 CTGCTCAGAACCCTCTGCCATGG - Intergenic
947372434 2:229462416-229462438 CTGACTGGAGCCATTTGCCAAGG - Intronic
1168804640 20:665319-665341 CCAGTTAGACCCACCTGCCAGGG + Intronic
1169293149 20:4370040-4370062 CTACTGAGACCCATCTGTCATGG - Intergenic
1169784178 20:9341121-9341143 CTGATTTGAGCCATCTCCCCAGG - Intronic
1169867080 20:10213757-10213779 CTGCTTCAACCCATCTGCTATGG + Intergenic
1177089580 21:16750675-16750697 TTGATTACAAACATCTGCCATGG + Intergenic
1178120612 21:29466415-29466437 CTTATTTCACCCATCTGACACGG - Intronic
1179999079 21:44987034-44987056 CTGAGTGGACCCAAGTGCCACGG - Intergenic
950144539 3:10639752-10639774 CTGATTTGAGGCCTCTGCCATGG - Intronic
954902014 3:54027952-54027974 CTGTTTACACCTAGCTGCCAGGG - Intergenic
956100261 3:65760838-65760860 CAGATGAGACCCATCTGAGAAGG + Intronic
956267071 3:67408599-67408621 CTAATTAGACCCATTTCCCTAGG - Intronic
959813634 3:110649468-110649490 CTGCTTATGCCCATCTGTCATGG - Intergenic
961106869 3:124249926-124249948 CTCATCAGTCCCCTCTGCCAGGG + Intronic
961441956 3:126958574-126958596 CTGCTCACACCCATCTGCCAAGG + Intronic
962282107 3:134059925-134059947 CTGCTGAGAACCATCTGCCCTGG + Intergenic
963965632 3:151366986-151367008 CTGATTCGCACCATATGCCAAGG - Intronic
964121281 3:153186148-153186170 CTGAATAGATCCACCTGCCTCGG + Intergenic
967127967 3:186442866-186442888 CTGCTTTGCCCCTTCTGCCATGG - Intergenic
973138523 4:46736254-46736276 CTGATTAAACCCTTCTTCCTTGG - Intronic
979174938 4:117651647-117651669 TTGATTACTCCCATCAGCCATGG - Intergenic
979175815 4:117661262-117661284 CAGATTAGACCCATATGGAATGG - Intergenic
979222590 4:118246370-118246392 CTCAGGTGACCCATCTGCCACGG - Intronic
981263400 4:142750719-142750741 CTGATTAGACCCATCTGCCAAGG - Intronic
982235572 4:153248825-153248847 CTGATTAGCTCCCTCTGCCAAGG + Intronic
987274475 5:16347305-16347327 CTGTTTAGAGACATTTGCCATGG - Intergenic
992157772 5:73971877-73971899 CTGAATAGACACACCTGCCTGGG - Intergenic
996584546 5:125070227-125070249 CTTATTAGACCCACCTGACCTGG + Intergenic
1000025976 5:157359536-157359558 CTGATTAGAGATGTCTGCCATGG - Intronic
1012397622 6:98818177-98818199 CTCATTACAAGCATCTGCCACGG - Intergenic
1012936595 6:105374243-105374265 GTGATTAGAACATTCTGCCAGGG - Intronic
1019202766 6:170332462-170332484 CTCAGGTGACCCATCTGCCACGG - Intronic
1025032593 7:55570085-55570107 CTGAAGAGAGCCATTTGCCATGG + Intronic
1025781192 7:64603337-64603359 CTGATTTGACTCTTCTGCCTGGG + Intergenic
1025782851 7:64617256-64617278 GTGATTTGACCCTTCTGCCTGGG + Intergenic
1026634460 7:72069277-72069299 CTCATTACACCCATCCACCAAGG - Intronic
1026897849 7:74020700-74020722 CTGATTACACGCATGAGCCATGG - Intergenic
1028441446 7:90867101-90867123 CATATTAGACCCAACTGCCTGGG - Intronic
1042121090 8:65489236-65489258 CTGATCATACTCATTTGCCAGGG - Intergenic
1043054508 8:75420721-75420743 CTGAGTAGACCCAGCTGACTGGG + Intronic
1046901669 8:119530177-119530199 CTAATGAAACCAATCTGCCAAGG + Intergenic
1050773400 9:9232691-9232713 CTAATTAGATCAATCTGCTAGGG + Intronic
1056783347 9:89568408-89568430 CTGATGGGACCCTTCTGCCAAGG + Intergenic
1061901463 9:133674305-133674327 CTGCTCTGACCCATCGGCCAGGG + Intronic
1185731758 X:2467349-2467371 CTGACTAGAGCTAACTGCCACGG - Intronic
1188699000 X:33235778-33235800 CAGATTAGCGCCATCTCCCATGG + Intronic
1195393624 X:104388219-104388241 CTGATATGACCCAACTGCAATGG - Intergenic
1200864298 Y:8026212-8026234 GTGATGTGACTCATCTGCCAAGG + Intergenic
1201714644 Y:17031177-17031199 TTGAGTAGACCCTTCTGTCAGGG + Intergenic
1202248079 Y:22839995-22840017 CTGATTTGACCCTTCTGACTAGG + Intergenic
1202262990 Y:22989135-22989157 GTGATTTGACTCTTCTGCCAGGG + Intronic
1202401067 Y:24473743-24473765 CTGATTTGACCCTTCTGACTAGG + Intergenic
1202415980 Y:24622876-24622898 GTGATTTGACTCTTCTGCCAGGG + Intronic
1202454807 Y:25047210-25047232 GTGATTTGACTCTTCTGCCAGGG - Intronic
1202469713 Y:25196343-25196365 CTGATTTGACCCTTCTGACTAGG - Intergenic