ID: 981266630

View in Genome Browser
Species Human (GRCh38)
Location 4:142791791-142791813
Sequence GGTGAGTAAGTAGCAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1002
Summary {0: 1, 1: 2, 2: 19, 3: 152, 4: 828}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981266630 Original CRISPR GGTGAGTAAGTAGCAGAGCC TGG (reversed) Intronic
900086089 1:898065-898087 GGTGAGTAAGAAGGGGAGCTCGG - Intergenic
900325876 1:2108413-2108435 GGTGAGTGAGAGGCACAGCCTGG + Intronic
901347761 1:8561946-8561968 GCTTAGTAAGTTGCAGAGCCAGG - Intronic
901607212 1:10468602-10468624 GGTTAGTAAATGGTAGAGCCAGG + Intronic
902256196 1:15190190-15190212 TGTTAATAAGTAGCAGAGCACGG - Intronic
902373432 1:16018970-16018992 GTTGCGTAAGTGGCAGAGCTGGG + Intronic
902391226 1:16108169-16108191 GGTGAGTAAGAAGGGGAGCTCGG - Intergenic
902445908 1:16464134-16464156 GGTTGGTAAGTGGCAGAGCTGGG + Intergenic
902556806 1:17251640-17251662 GGCCAGTGAGTGGCAGAGCCAGG + Intronic
902674543 1:17999592-17999614 GGTGAGGAAGTGGCAGAGCCAGG - Intergenic
902740100 1:18431962-18431984 AGTTAGCAAGTAGCAGAGCTAGG + Intergenic
902746795 1:18480090-18480112 AGTTGGTAAGTAGCAGAGCCAGG + Intergenic
902918843 1:19654889-19654911 GGTTAGTAAGTGGGAGAGCTGGG + Intronic
902931789 1:19736574-19736596 GGAGAGTGAGTTGCCGAGCCTGG - Intronic
902965484 1:19998035-19998057 GGTGAGTAAGAAGGGGAGCTCGG + Intergenic
903071200 1:20727741-20727763 GCTGGGGAAGCAGCAGAGCCTGG - Intronic
903225419 1:21892036-21892058 GGTGTGTAGGTGGCAGAGCAGGG + Intronic
903426639 1:23258440-23258462 AGTGTGTAAATGGCAGAGCCAGG - Intergenic
903576649 1:24343501-24343523 AGCTAGTAAGTGGCAGAGCCAGG + Intronic
903593660 1:24477623-24477645 GGTGGGTAAGTGGCAGAGCCTGG + Intergenic
903657417 1:24957850-24957872 AGCGAGGAAGTGGCAGAGCCTGG + Intronic
903663707 1:24994352-24994374 GGTGAGTCAGTGGCAGAACCAGG - Intergenic
903770541 1:25761039-25761061 GGTCCTTAAGTGGCAGAGCCAGG - Intronic
904298921 1:29541727-29541749 AGTGAGCAATTATCAGAGCCTGG + Intergenic
904353794 1:29925569-29925591 AGTGAATAAGTGGCAGAGCCAGG - Intergenic
904485419 1:30821813-30821835 GGTGAGTTAAAGGCAGAGCCTGG + Intergenic
904574290 1:31493039-31493061 TGTCAGTAAGTGGCAGAGCCAGG - Intergenic
904608606 1:31712880-31712902 AGCCAGGAAGTAGCAGAGCCAGG - Intergenic
904626718 1:31810255-31810277 CGCGAGTAAGTGGCCGAGCCAGG - Intronic
904841823 1:33377112-33377134 GGCTAGAAAGTGGCAGAGCCAGG - Intronic
904884804 1:33728075-33728097 GGTTAGCAAGTTGCAGAGCTTGG + Intronic
904908461 1:33915904-33915926 GGCGAGTAAGGAGCAGAGCTGGG - Intronic
905012098 1:34754799-34754821 AGTGAGAAAGTGGCAGAGCTGGG + Intronic
905336200 1:37246317-37246339 GATGAGTAAATGGCAGAGCCTGG + Intergenic
905356649 1:37389568-37389590 AGTGAAAAAGCAGCAGAGCCAGG + Intergenic
905455704 1:38086621-38086643 AGCTAGTAAGTGGCAGAGCCAGG + Intergenic
905528123 1:38654945-38654967 AGTGAGCAAGTAGCTGAGCTGGG + Intergenic
905646435 1:39627689-39627711 GCTAGTTAAGTAGCAGAGCCAGG - Intronic
905835954 1:41121299-41121321 AGTTAGTAAATAGCAGAGCCAGG + Intronic
906257466 1:44361132-44361154 AGTCAGTAAGTGTCAGAGCCAGG - Intergenic
906376127 1:45298142-45298164 AGTTAGTAAATAGCAGAGCCAGG - Intronic
906476252 1:46171488-46171510 GGTGAGGAAGGAACAGAGGCCGG + Intronic
906523688 1:46481685-46481707 AGCTAGTAAGTAGCAGAGCCTGG + Intergenic
907280484 1:53344034-53344056 GGCCAGTAAGGAGCAGGGCCGGG + Intergenic
907312407 1:53546459-53546481 GGCGAGTAAGCAGCAGGGCTGGG - Intronic
907354514 1:53861441-53861463 TGTGAGCTAATAGCAGAGCCAGG - Intronic
907377771 1:54058005-54058027 AGGTAGTAAGTAGCAGAGCTGGG - Intronic
907465261 1:54630886-54630908 GGTGAGTAAGAAGGGGAGTCCGG + Exonic
907551732 1:55310504-55310526 GGTGAGTAAGTAGCAGATCCTGG - Intergenic
907771709 1:57472117-57472139 AGTGAGTATGTGGCAGAGCCAGG + Intronic
907831293 1:58066628-58066650 AATGAGTAAGAAGTAGAGCCAGG + Intronic
907901230 1:58743239-58743261 AGTGTGTAAGTGGCAGAGCTGGG + Intergenic
907929361 1:58984903-58984925 GGTGACTGAGTAGCAGAGTTAGG + Intergenic
908098301 1:60763564-60763586 GGTCTGTAAGCAGCAGAGACTGG - Intergenic
908098484 1:60765461-60765483 AGCTAGTAAGTGGCAGAGCCTGG - Intergenic
908264284 1:62362955-62362977 AGTCAGTAAGTAGCAGGGTCTGG - Intergenic
908329153 1:63053401-63053423 AGTTAGTAAGTAGCAGAGCTGGG + Intergenic
908683271 1:66686141-66686163 AGCTAGTAAGTAGCAGAGCCAGG + Intronic
908729607 1:67212513-67212535 GACTAGAAAGTAGCAGAGCCAGG - Intronic
908783967 1:67716971-67716993 GGAGAGTGAGCTGCAGAGCCTGG + Intronic
908879735 1:68717581-68717603 GGCTGGCAAGTAGCAGAGCCAGG - Intergenic
909315909 1:74218658-74218680 GGTGAGTTAATAGCAGTGCTAGG - Intronic
909786719 1:79622645-79622667 GGTGAGTAAGTGGTAGAACCAGG - Intergenic
910427273 1:87130241-87130263 GGTGAGTATGTAGCCCAGCAGGG + Intronic
910719177 1:90266649-90266671 GGCCAGTAAATAGCAGAGTCAGG - Intergenic
911032055 1:93499333-93499355 GGGGAGCTAGTAGAAGAGCCTGG + Intronic
911061401 1:93751192-93751214 GGGGAGGAAGTGGCAGAGCTGGG + Intronic
911213645 1:95168358-95168380 GGTAAGCAAGTAGAAGAGGCAGG - Intronic
911582018 1:99644895-99644917 AGCTAGTAAGTAGCAAAGCCAGG - Intergenic
911957056 1:104250615-104250637 GCTGAGAAAGGAGCAGAGCTGGG + Intergenic
912164552 1:107027875-107027897 AGTGAGTAAGTGGCAGAACCGGG - Intergenic
912200458 1:107452000-107452022 ACTTAGTAAGTGGCAGAGCCAGG - Intronic
912253740 1:108038006-108038028 GAAGAGTAAGTTGCAGAGCCCGG - Intergenic
912331535 1:108824553-108824575 AGCTAATAAGTAGCAGAGCCAGG - Intronic
912647221 1:111404787-111404809 CGTAAGTAAGCGGCAGAGCCAGG - Intergenic
912699571 1:111867015-111867037 GGTGACTAACTGGCAGAGCGAGG - Intronic
912746690 1:112251219-112251241 TGTGAGTAAGTACCTGAGGCAGG - Intergenic
912849508 1:113110014-113110036 TGTCAGTCAGTGGCAGAGCCTGG - Intronic
913083331 1:115410481-115410503 CCATAGTAAGTAGCAGAGCCAGG + Intergenic
913195186 1:116450427-116450449 GCTGAGTAAATGACAGAGCCAGG - Intergenic
913241095 1:116830133-116830155 AGTGAGTAAGTGGCAGAGCTGGG - Intergenic
914354764 1:146875048-146875070 GGGTAGTAACTAGCAGTGCCTGG + Intergenic
914982096 1:152424034-152424056 GGTGAGTAAGAAGGGGAGCTAGG - Intergenic
915113108 1:153577379-153577401 GGTGAAGGAGTGGCAGAGCCAGG - Intergenic
915163920 1:153937899-153937921 GGTGGGCATGGAGCAGAGCCAGG + Intronic
915179746 1:154047964-154047986 GGTGAGTAAGAAGGGGAGCTTGG + Intronic
915520357 1:156438873-156438895 GTTTAGTAAGTGACAGAGCCAGG - Intergenic
915638028 1:157199851-157199873 AGTGAGTAACTGGCAGAGCCAGG - Intergenic
916239111 1:162621887-162621909 GGTCAATAAGTAGCAGAACATGG + Intergenic
916790103 1:168117454-168117476 AGGCAGTAAGTAGCAGAGCTGGG - Intronic
917232999 1:172857971-172857993 GGTGAGAGAGGACCAGAGCCAGG - Intergenic
917247083 1:173015323-173015345 GGTTAGTAAGTGGCAGAGCTAGG + Intergenic
917360009 1:174164894-174164916 AGTGAGTTATTAGCAAAGCCAGG + Intronic
917537551 1:175885329-175885351 GGGTAGTAAGTGGCAGAGCTGGG + Intergenic
917702443 1:177594893-177594915 AGCTAGTAAGTGGCAGAGCCAGG - Intergenic
917750547 1:178049486-178049508 AGTGAGTAAGTAGCTAACCCAGG - Intergenic
917799728 1:178559834-178559856 GGTGAGTAAGAAGGGGAGCTCGG - Intergenic
917944023 1:179951130-179951152 GGCTAGTAAGTAGCTCAGCCAGG + Intergenic
918413329 1:184283117-184283139 TTTGAGTAAGTGGTAGAGCCAGG + Intergenic
918433632 1:184487744-184487766 TGTTAGTGAGTAGCCGAGCCAGG - Intronic
918587749 1:186207321-186207343 GGATAGTAAATGGCAGAGCCTGG + Intergenic
918971727 1:191428395-191428417 GGTGAGGAAGTAGCAATGGCAGG + Intergenic
919137476 1:193528944-193528966 AGGTAGTAAGCAGCAGAGCCAGG - Intergenic
919417104 1:197324663-197324685 ACTTAGTAAGTGGCAGAGCCAGG + Intronic
919776997 1:201200607-201200629 GTTTAGTAAGTATCAGAACCAGG - Intronic
919785189 1:201254186-201254208 GGTGAGTTAGTGCCAGAGCTGGG + Intergenic
919867200 1:201791460-201791482 GGGGAGAAAGTACCACAGCCTGG - Intronic
919912148 1:202118190-202118212 AGTTAGTAAGTGGCAGGGCCAGG + Intergenic
920106709 1:203558407-203558429 GGTAAGTAAGCGGCAGTGCCAGG + Intergenic
920447499 1:206029876-206029898 GGCCAGTTAGTGGCAGAGCCAGG - Intergenic
920553337 1:206884298-206884320 AGCTAGTAAGTTGCAGAGCCAGG + Intergenic
920633059 1:207671066-207671088 AGTTGGTAAGTAGCAGAGTCTGG - Intronic
920905681 1:210165140-210165162 GGTAAGTAAGTAGTAGAACTGGG + Intronic
920982685 1:210853154-210853176 GGCCAGTAAGTGGCAGAGCTAGG - Intronic
921227161 1:213031800-213031822 GGTGAGTAAGAAGGGGAGCTCGG - Intergenic
921358293 1:214306846-214306868 AGCTAGTAAGTAGCAGAGCCAGG - Intronic
921414781 1:214872835-214872857 GGTCAGTCACCAGCAGAGCCCGG + Intergenic
921544120 1:216453939-216453961 AGTTAATAAGCAGCAGAGCCAGG + Intergenic
921887816 1:220324120-220324142 GGTTAGTAAGCAGCAGAGGCAGG + Intergenic
921949724 1:220916866-220916888 AGTGAGTAAAGAGCAGAGCTGGG + Intergenic
922079832 1:222284993-222285015 GCTTGGTAAGTAGCAGTGCCTGG - Intergenic
922616518 1:226964293-226964315 GATGAGGAAGTAGCAGAGAAGGG + Intronic
924928101 1:248703114-248703136 GGTGAGTAAGGAGGAGAACAAGG - Intergenic
1063358586 10:5427993-5428015 GTGGAGAAAGTAACAGAGCCAGG - Intronic
1064014162 10:11759962-11759984 GGTTAGTAAGTGGCAGAGCTGGG + Intronic
1064220090 10:13432865-13432887 AGTTAACAAGTAGCAGAGCCAGG - Intergenic
1064986709 10:21217592-21217614 AGCTAGTAACTAGCAGAGCCTGG - Intergenic
1066297384 10:34066745-34066767 GGTGAGCAGGAAACAGAGCCAGG + Intergenic
1066469957 10:35688719-35688741 AGTTAGTAAGTGGTAGAGCCTGG + Intergenic
1067538507 10:47135051-47135073 AGTGGGGAAGTAGCAGAACCAGG + Intergenic
1067963572 10:50883841-50883863 AGTTAGCAAGTGGCAGAGCCAGG - Intronic
1068714740 10:60175779-60175801 AGATAGTAAGTAGCAGAGCTGGG - Intronic
1069568942 10:69482732-69482754 GGTTAGCAAGTAGCAGAGCTGGG + Intronic
1069915951 10:71786929-71786951 GGTGAGTTAGCAGCAGAGTGGGG - Intronic
1070111325 10:73489613-73489635 GGTTATTAAGTAGTAGAGCTAGG + Intronic
1070240198 10:74672897-74672919 GGCTAGAGAGTAGCAGAGCCAGG + Intronic
1070729867 10:78819169-78819191 AGCGAGTAAGTGGCAGAGCTGGG - Intergenic
1070894912 10:79975440-79975462 GGTGAGTAAGAAGGGGAGCTTGG - Intronic
1070925266 10:80216767-80216789 GGTGAGGTAGAATCAGAGCCTGG + Intergenic
1071260944 10:83918424-83918446 GGTGAGTTAAGAGCAGATCCAGG + Intergenic
1071404352 10:85315802-85315824 TGTGAGCAAGTGACAGAGCCAGG + Intergenic
1072410201 10:95194860-95194882 GGTTATTTAGCAGCAGAGCCAGG - Intronic
1072665369 10:97388826-97388848 GGTGAGTTAGTTGTAGAGCAGGG - Intronic
1072845743 10:98828368-98828390 GCTAAGTAAGTGGTAGAGCCTGG + Intronic
1073029265 10:100511959-100511981 GGACAGCAAGTAGCAGAGCTGGG + Intronic
1073038202 10:100579014-100579036 AGTAAGTAAGTGGCAGTGCCAGG - Intergenic
1073803170 10:107065923-107065945 GCTCAGTGAGTAGCAGAGACAGG + Intronic
1074052605 10:109893825-109893847 GCTAATTAAGTAGCAGAGGCAGG + Intronic
1074226127 10:111486120-111486142 GGTTAGTAATTATCAGAGCTGGG - Intergenic
1074259189 10:111834735-111834757 GGTTATTAAGTAGCAGAGCCAGG + Intergenic
1074711999 10:116185198-116185220 AGTTAGGAAGTAGCAGAGCTGGG - Intronic
1075556872 10:123439257-123439279 GGTGACTTAGTGGCAGAGCCAGG + Intergenic
1075597339 10:123741735-123741757 ATTGAATATGTAGCAGAGCCGGG - Intronic
1075991367 10:126841685-126841707 GGTGAGTCAGAGACAGAGCCAGG - Intergenic
1076084070 10:127609944-127609966 GGTGAGTGTGTGGAAGAGCCAGG + Intergenic
1076142457 10:128090735-128090757 GGTTAGTAAGAAGCAAAGCATGG + Intergenic
1076281849 10:129252962-129252984 CTTGAGTAAATAGCAGGGCCTGG + Intergenic
1077486181 11:2839310-2839332 AGGGAGTCAGTGGCAGAGCCAGG - Intronic
1077542808 11:3155455-3155477 GGGGAGTGAGTGGCAGAGCTAGG - Intronic
1077542824 11:3155513-3155535 GGTGAGTGAGTGGCAGACCTGGG - Intronic
1077542828 11:3155535-3155557 GGTGAGTGAGTGGCAGAGCTGGG - Intronic
1077542836 11:3155575-3155597 GGGGAGTGAGTGGCAGAGCTGGG - Intronic
1077542847 11:3155615-3155637 GGTGAGTGAGTGGCAGACCTGGG - Intronic
1077542851 11:3155637-3155659 GGTGAGTGAGTGGCAGAGCTGGG - Intronic
1078094401 11:8287807-8287829 GGTGAGTTAGTGGCCAAGCCAGG - Intergenic
1078527008 11:12109155-12109177 GGTTAGTAAGTATCAGAGTCCGG - Intronic
1078674146 11:13393848-13393870 GGGGAATAAATAGCAGAGCCAGG - Intronic
1078735019 11:14011882-14011904 GGTTAATAAGCAGGAGAGCCAGG - Intronic
1078762507 11:14262515-14262537 GGTTGGTAAGCAGCAGAGGCAGG - Intronic
1078895922 11:15597125-15597147 GGTAAGTCAAGAGCAGAGCCAGG + Intergenic
1078905583 11:15685335-15685357 GCTGATTTAGTAGCAGGGCCAGG - Intergenic
1079010057 11:16820691-16820713 GGGGAGTGAGCTGCAGAGCCAGG - Intronic
1079099221 11:17530402-17530424 GGCCAGTAAGTGGCAGAGCCAGG - Intronic
1079292342 11:19199561-19199583 GCTGAGAAAGCGGCAGAGCCAGG - Intronic
1079348371 11:19672430-19672452 GGTCAGTTGGTGGCAGAGCCAGG - Intronic
1079889749 11:26036579-26036601 AATAAGTAAGTAGCAGAACCAGG + Intergenic
1080366685 11:31582133-31582155 AGTAATTAAGTAGCAGACCCAGG - Intronic
1080880197 11:36312613-36312635 GTTTAGTAAGTGGCAGAGCCAGG - Intronic
1081218653 11:40433804-40433826 GGTGAGAAACCAGCAGAGCGAGG + Intronic
1081333222 11:41830465-41830487 AGTTAGTAAATTGCAGAGCCTGG + Intergenic
1081441776 11:43088912-43088934 AGTGAGTAAGTAGTTGAGCCAGG + Intergenic
1081591444 11:44426009-44426031 AGTGAGTGAGTGGCAGAGCCGGG - Intergenic
1081647455 11:44799739-44799761 AGTCAGGAAGTGGCAGAGCCAGG + Intronic
1081856554 11:46307865-46307887 GGTGAAGCAGGAGCAGAGCCCGG + Exonic
1082794031 11:57367276-57367298 AGTCAGTAAGCGGCAGAGCCAGG + Intronic
1083183681 11:61005086-61005108 AGTGAGCAAGCTGCAGAGCCCGG - Intronic
1083191846 11:61057673-61057695 GGCGGGTAAGTGGCAGGGCCAGG + Intergenic
1083541558 11:63515111-63515133 GACTAGAAAGTAGCAGAGCCAGG + Intronic
1083945210 11:65919543-65919565 GGTGAGCACGTGGCAGAGCCCGG + Exonic
1083997239 11:66278473-66278495 GGTGAGCATGTAGCAGAACGCGG - Exonic
1084018726 11:66404017-66404039 GGACAGTAAGTAGCAAAGCCGGG - Intergenic
1084033251 11:66493285-66493307 GGTTGGGAAGTGGCAGAGCCAGG - Intronic
1084036023 11:66510874-66510896 GGTGAGCCAGTGGCGGAGCCTGG + Intronic
1084386661 11:68847204-68847226 GGCTAGTAAGTGGCAGAGACAGG - Intergenic
1084913541 11:72410253-72410275 ACTTAGTAAGTAACAGAGCCTGG - Intronic
1084969194 11:72760697-72760719 AGCTGGTAAGTAGCAGAGCCAGG + Intronic
1085256765 11:75178227-75178249 AATTAGTAAGTAGCAGAGCCTGG - Intronic
1085344639 11:75760390-75760412 GCTTAGGAAGTGGCAGAGCCAGG - Intronic
1085626659 11:78079128-78079150 GGCTATTAAGTAGCAGAGCTTGG - Intronic
1085659141 11:78346834-78346856 GGGCATTAAGTATCAGAGCCAGG + Intronic
1085721802 11:78918916-78918938 GCTGAGTGAGTGGCAGAGCTGGG - Intronic
1085777476 11:79379706-79379728 AGTGAGTAAGTGGCAGAGGCAGG + Intronic
1085777754 11:79381830-79381852 AGTGAGTAAGTGGCAGAGGCAGG + Intronic
1085844013 11:80045040-80045062 GGGGAGTAAGCAGCAGTGTCAGG - Intergenic
1086100726 11:83096781-83096803 GGTTAGCAAATAGCAGAGCTGGG - Intergenic
1086289797 11:85294506-85294528 ATTTAGTAAGTAGCAGAGCCAGG - Intronic
1086830873 11:91561896-91561918 AGTGAGTAAATAATAGAGCCAGG + Intergenic
1087662230 11:101001096-101001118 GGCTAGTAAGTGGCAGAGCTGGG - Intergenic
1087666485 11:101054668-101054690 TGTTAGTAAGTGGTAGAGCCAGG - Intronic
1087926634 11:103926114-103926136 GGTCAGTAAATCACAGAGCCAGG - Intronic
1088815925 11:113420821-113420843 GGTGATTTAGTAGCAGAGGAAGG + Intronic
1088940536 11:114450655-114450677 GGTCAGTAAGTAGCTGAGAAAGG + Intergenic
1088945991 11:114513005-114513027 GGTGGGTGAGCAGCAGAGACAGG + Intergenic
1089361126 11:117887442-117887464 AGTTGGTAAGTGGCAGAGCCAGG + Intergenic
1089365279 11:117917651-117917673 GGTGAGTTAGTGGCAGAGTAGGG + Intronic
1089538757 11:119176906-119176928 AGCTAATAAGTAGCAGAGCCTGG - Intronic
1089620487 11:119719439-119719461 AGCTAGTAAGTGGCAGAGCCAGG - Intronic
1089635039 11:119806636-119806658 GGCTAGTAATCAGCAGAGCCTGG - Intergenic
1089685876 11:120146588-120146610 GGTGAATAACTAGCAGAACTGGG + Intronic
1089789371 11:120931567-120931589 AGCAAGTAAGTGGCAGAGCCAGG - Intronic
1090034128 11:123233557-123233579 GGCTAGAAAGTAGCAGAGTCAGG + Intergenic
1090059917 11:123455614-123455636 AGAGAGTAAGTGGCAGAGCCTGG - Intergenic
1090426747 11:126612432-126612454 AGACAGTTAGTAGCAGAGCCAGG - Intronic
1090478887 11:127050174-127050196 GGCCAGTAAGTAGTAGAGTCAGG + Intergenic
1090665634 11:128913362-128913384 GGTGAGTCAGTAGCTGAGCAGGG - Intronic
1090879621 11:130822260-130822282 AGTTAGTAAGTAGCAGAACTGGG - Intergenic
1090917939 11:131182815-131182837 AGCCAGTAAGTAGCAGAGCTGGG - Intergenic
1091079379 11:132652516-132652538 AGTGAGTAAGTAGCAGAGCTGGG - Intronic
1091390254 12:121919-121941 ACATAGTAAGTAGCAGAGCCGGG + Intronic
1091724093 12:2833891-2833913 AGTTAGTAAATGGCAGAGCCAGG + Intronic
1091825968 12:3512986-3513008 GATGAGCAAGTTACAGAGCCTGG - Intronic
1091837721 12:3597363-3597385 CGTTAGTAAGCAGCAGTGCCAGG - Intergenic
1091884419 12:4005559-4005581 AGTTAGTAAGTAGAAGAGTCAGG - Intergenic
1091884953 12:4010010-4010032 AGTGAGTTAGTGGCAGAGCAGGG - Intergenic
1092068405 12:5612409-5612431 AACTAGTAAGTAGCAGAGCCAGG - Intronic
1092099058 12:5868344-5868366 AGGGAGTAAGTGGCAGAGCTGGG - Intronic
1092141866 12:6189535-6189557 TGTTAGGAAGCAGCAGAGCCGGG - Intergenic
1092347761 12:7730174-7730196 AGAGACTAAGTAGCAGATCCAGG - Intronic
1092385063 12:8030680-8030702 AATTAGTAAGTAGCAGAGTCAGG - Intergenic
1093737704 12:22640764-22640786 GGTTTGTATGTAGCAGAGCTGGG + Intronic
1094023685 12:25940886-25940908 GGGTAGAAAGAAGCAGAGCCAGG + Intergenic
1094486628 12:30930498-30930520 GGAGAGGAAGGGGCAGAGCCAGG - Intronic
1095938321 12:47709102-47709124 GGCCAGTAAGCAACAGAGCCTGG + Intergenic
1096450816 12:51739624-51739646 GGTGAGTAAGAAGGGGAGCTCGG - Intronic
1096491789 12:52016639-52016661 GGGGAGTAAGAAGCAGAGGCCGG - Intergenic
1096562108 12:52443136-52443158 GGTGGGTAAGAGGCAGAGCCAGG - Intergenic
1096810036 12:54163298-54163320 AGTTAATAAGTGGCAGAGCCAGG - Intergenic
1096814331 12:54192147-54192169 CATGAGTAAGTGGCAGAGCTTGG - Intergenic
1097262997 12:57729965-57729987 GGCCAGTAAGTGGCAGAACCAGG - Intronic
1097279498 12:57835847-57835869 AGTCAGTAACTGGCAGAGCCTGG - Intronic
1098138237 12:67425644-67425666 GATGAGTAAGTGGCTGAGCTGGG - Intergenic
1098528018 12:71509152-71509174 AGCTAGTAAGTGGCAGAGCCAGG - Intronic
1098870908 12:75815902-75815924 GCTTAGTAAGTACCAGGGCCAGG + Intergenic
1098945757 12:76587879-76587901 TGAGAGTTAGTAGCAGAGACAGG - Intergenic
1099367843 12:81791476-81791498 TCTGAGTAAGTGGCAAAGCCAGG + Intergenic
1099927013 12:89030819-89030841 ACAGAGTAAGTAGCAGAGCTGGG - Intergenic
1100350390 12:93775600-93775622 AGTTAGTAAGTGGCAGAGCTTGG + Intronic
1100478197 12:94953311-94953333 TGCTGGTAAGTAGCAGAGCCAGG + Intronic
1100685502 12:96982968-96982990 GGTGAATAAGTGGCAGAGCTGGG + Intergenic
1100752637 12:97716005-97716027 ACTGAGTAAGTTGCACAGCCAGG - Intergenic
1100986822 12:100209631-100209653 AGTTAGGAAGTACCAGAGCCAGG - Intronic
1101000748 12:100355321-100355343 AGCTAGTAAGTAGCAGAGCCAGG - Intergenic
1101027194 12:100621978-100622000 AGCTAGTAAGTAGCAGAGCCAGG - Intronic
1101045714 12:100803660-100803682 GGTGAGTAAGTGGCAGAGTAAGG - Intronic
1101239550 12:102824528-102824550 GGTGGGGAAGAAGCAGAGCAAGG + Intergenic
1101481878 12:105106178-105106200 GGTTAGTAAGTGGCAGAGCCAGG + Intergenic
1101641795 12:106591026-106591048 GATGAGTAAGTGGCAGAACCAGG + Intronic
1101651960 12:106685344-106685366 AGTGAGTAAGGAGCAGAGGCAGG - Intronic
1101654704 12:106709653-106709675 AGGTAGTAAGTAGCAGAGACAGG + Intronic
1101726479 12:107392447-107392469 GGTGAATGAGAAGCAGAGGCAGG - Intronic
1101815778 12:108145054-108145076 AGTAAGTGAGTAGCAGAGCTGGG - Intronic
1101839218 12:108315956-108315978 GGTGAGTGAGGAGCAGACGCAGG + Intronic
1101876602 12:108600155-108600177 GGTGAGTTAGTGGCAGGCCCTGG + Intergenic
1101965757 12:109280954-109280976 GGCTAGTAAGTGGCAGAGTCCGG - Intronic
1102030877 12:109739468-109739490 GGTGGGTAAGAAGCAAGGCCTGG + Intronic
1102260803 12:111442328-111442350 GGTAAGTAAGTGGTAGAGCTAGG + Intronic
1102754428 12:115325943-115325965 GCTGGGTAAATGGCAGAGCCAGG - Intergenic
1103014917 12:117486734-117486756 AGTAAGTAAGGAGCAGAGCTGGG - Intronic
1103160677 12:118726601-118726623 GGTGATTAAGTGGCAGAGCCAGG - Intergenic
1103211120 12:119167224-119167246 AGTGAGGAAGTAGCAGAGTTAGG - Intergenic
1103367431 12:120393573-120393595 AGCTAGTAAGCAGCAGAGCCAGG + Intergenic
1103657739 12:122486893-122486915 GGTTAGTGAGTGGCAAAGCCAGG - Intronic
1103738777 12:123077826-123077848 GGGGACAAAGTATCAGAGCCAGG + Intronic
1104552908 12:129773837-129773859 GGCAAGTAAGTGGCAGAGCTGGG - Intronic
1104884849 12:132100733-132100755 GGTCAATAAGTTGAAGAGCCGGG + Intronic
1105469970 13:20684772-20684794 GGTGAGTAAGAAGGGGAGCTCGG - Intronic
1105585687 13:21740863-21740885 GCTCAGTACGTGGCAGAGCCAGG + Intergenic
1106369835 13:29121620-29121642 TGTGAGTGACTAGCAGAGCAGGG - Intronic
1106517526 13:30468002-30468024 AGCTAGTAAGTAGCAGAGCTGGG - Intronic
1107677878 13:42815972-42815994 AGCTAGTAAGTAGCAGAGACAGG - Intergenic
1108283427 13:48881980-48882002 ATCTAGTAAGTAGCAGAGCCTGG - Intergenic
1108908364 13:55508703-55508725 GTTCAGTGAGCAGCAGAGCCTGG - Intergenic
1109297106 13:60547457-60547479 AGGTAGTAAGTGGCAGAGCCAGG - Intronic
1110229281 13:73151864-73151886 GCTGGTTAAGTGGCAGAGCCAGG + Intergenic
1111337788 13:86845940-86845962 GGTGAGTGAGTGGGAGACCCTGG + Intergenic
1111795569 13:92915033-92915055 GGTCAGTAAGTGGCAAAGGCAGG + Intergenic
1113331554 13:109332809-109332831 GGTGAGTAAGTGGCAGAGCGAGG - Intergenic
1113411451 13:110093865-110093887 GGCAAGTTAGGAGCAGAGCCAGG - Intergenic
1114414050 14:22527614-22527636 AGTGAGTGAGTGGCTGAGCCGGG - Intergenic
1114591258 14:23866870-23866892 AGCTAGTAAGTGGCAGAGCCAGG + Intergenic
1115451806 14:33556692-33556714 GGCCAGTCAGTGGCAGAGCCAGG - Intronic
1115599974 14:34946755-34946777 AGTTAGTAAATGGCAGAGCCAGG - Intergenic
1115630854 14:35243683-35243705 GGCCAGTAAGTAGCAGAACTAGG - Intronic
1115810167 14:37098429-37098451 AGTGAGTTAGTGGCAGAGCTGGG - Intronic
1116700405 14:48234398-48234420 AGTTAGTAAGTGGCAGAGTCAGG - Intergenic
1117432242 14:55679008-55679030 GGCTACTAAGTGGCAGAGCCAGG - Intronic
1117530480 14:56656077-56656099 AGTGAGGAAGTGGCAGAGCTGGG - Intronic
1117804314 14:59474624-59474646 AGTTAGTGAGTAGCAGATCCAGG - Intronic
1118021722 14:61723382-61723404 GGTTAGTAAATGGCAGAGCTTGG + Intronic
1118856904 14:69630226-69630248 AGCAGGTAAGTAGCAGAGCCAGG + Intronic
1118882645 14:69842433-69842455 AGTCAGAAAGTGGCAGAGCCAGG + Intergenic
1118883580 14:69849016-69849038 AGTGAGTAAGTGGGACAGCCTGG + Intergenic
1119543516 14:75455939-75455961 GCTGAGAAAGCAGCAGAGCCTGG - Intronic
1120870091 14:89329233-89329255 GGTGTGTAAGCATCACAGCCTGG - Intronic
1120984752 14:90324731-90324753 GGTTAGTAAGTCACAGAGTCAGG - Intronic
1121041674 14:90754208-90754230 GGTAAGTAAGTGGCAGAGCTAGG + Intronic
1121590397 14:95101953-95101975 GGCAAGTAAGTGGCAGAGCTTGG - Intronic
1121792560 14:96710024-96710046 GGCTAGTAAGTGGCAGAGCTGGG - Intergenic
1121794782 14:96725740-96725762 GCTCAGTAAGCAGCAGAGCCAGG - Intergenic
1202843837 14_GL000009v2_random:148789-148811 GGTGAGTAAGAAGGGGAGCTCGG - Intergenic
1123789057 15:23701339-23701361 GGTGAGTAAGAAGGGGAGCTTGG - Intergenic
1123984909 15:25636684-25636706 GGTGAGTAAGAAGGGGAGCTTGG + Intergenic
1124236356 15:27992530-27992552 GGTGAGCAGGCACCAGAGCCAGG + Intronic
1124887683 15:33702145-33702167 GGTTAGTCAGTGGCACAGCCAGG + Intronic
1124902320 15:33835875-33835897 GGTGAGGAGGTGGCAGGGCCAGG - Intronic
1125682727 15:41542632-41542654 AGTTAGTAAATGGCAGAGCCTGG - Intronic
1125768797 15:42151800-42151822 AGCCAGTAAGTAGTAGAGCCAGG - Intronic
1126321520 15:47429232-47429254 AGGTAGTAAGCAGCAGAGCCAGG - Intronic
1126673012 15:51133491-51133513 GGATAGTGGGTAGCAGAGCCAGG + Intergenic
1126895731 15:53255328-53255350 AGCGAGTAAGTGGGAGAGCCAGG - Intergenic
1127280405 15:57486060-57486082 GGTGAGTCAGGAGCAGGGCCCGG + Intronic
1127393912 15:58528456-58528478 AGTTAATAAGTAGCAGAGCTGGG + Intronic
1127850036 15:62904229-62904251 AGTTAATAAGTGGCAGAGCCAGG + Intergenic
1128338689 15:66804785-66804807 AGTCAGTAAGTGGCGGAGCCTGG - Intergenic
1128396704 15:67233636-67233658 AGCTAGTAAGTGGCAGAGCCTGG - Intronic
1128720554 15:69944712-69944734 TGCGAGTAAGTAGAAAAGCCAGG + Intergenic
1128931548 15:71709066-71709088 GGTTAGTATGTAGCAGAGTAGGG - Intronic
1129994489 15:79992813-79992835 AGCTAGTAAGTAGCAGAGCCAGG + Intergenic
1130132746 15:81158004-81158026 AGTTGGTAAGTAGGAGAGCCAGG - Intergenic
1130727571 15:86455827-86455849 AGGTAGTAAGTGGCAGAGCCAGG + Intronic
1131383831 15:91986224-91986246 GGTGGGCAAGCAGCTGAGCCTGG + Intronic
1131538573 15:93257139-93257161 GGTTAAGAAGTAGCAGAGCTGGG - Intergenic
1131812463 15:96186696-96186718 GGTCAGTAACAGGCAGAGCCAGG + Intergenic
1132823212 16:1887889-1887911 GGTGAGGAAGTCACAGAGGCAGG - Intergenic
1133044641 16:3080942-3080964 GGTGAGTAAGAAGGGGAGCTCGG - Intronic
1133968045 16:10545994-10546016 GTGCAGTAAGCAGCAGAGCCAGG - Intronic
1134757600 16:16682007-16682029 AGCTGGTAAGTAGCAGAGCCGGG - Intergenic
1134988468 16:18677159-18677181 AGCTGGTAAGTAGCAGAGCCGGG + Intergenic
1135051885 16:19200036-19200058 AGTTAGTAAATGGCAGAGCCAGG + Intronic
1135252329 16:20911555-20911577 GGTGAGTAAGTAGCAAGGCCAGG - Intronic
1135423251 16:22318496-22318518 GGCTAGGAAGTAGCAGAGCCAGG - Intronic
1135463839 16:22668557-22668579 AATTAGTAAGTAGCAGGGCCAGG + Intergenic
1135660318 16:24291020-24291042 GGCTAGTAAGTGGCAGAGCTAGG - Intronic
1135716867 16:24778342-24778364 AGTGAATAAGTAGCAGATCCTGG + Intronic
1135851974 16:25971992-25972014 AGCTAGTAAGTGGCAGAGCCAGG - Intronic
1136088185 16:27900404-27900426 GGCAAGTAAGTGGCAGAGCTGGG + Intronic
1136458736 16:30396989-30397011 GGTTAGAAAGTAGCAAAGCCAGG - Intronic
1136637209 16:31532061-31532083 GGAAAGTAAGCAGCAGAGTCAGG - Intergenic
1136638364 16:31540340-31540362 GGTGAGTAAGAAGGGGAGCTTGG + Intergenic
1136669864 16:31846516-31846538 GGAAAGTAAGCAGCAGAGTCAGG + Intergenic
1136928262 16:34395410-34395432 AGTTAACAAGTAGCAGAGCCAGG + Intergenic
1136976312 16:35016394-35016416 AGTTAACAAGTAGCAGAGCCAGG - Intergenic
1137794510 16:51204094-51204116 CGTGAGTAAGTAGCTGAGCTTGG + Intergenic
1137944299 16:52718839-52718861 GGTGAGAATGTTGTAGAGCCAGG - Intergenic
1137969220 16:52967183-52967205 ATTCAGTGAGTAGCAGAGCCTGG - Intergenic
1138276528 16:55738836-55738858 AGCCAGTAAGTAGCAGAGCCAGG + Intergenic
1138282453 16:55782194-55782216 AGCCAGTAAGTAGCAGAGCCAGG + Intergenic
1138286495 16:55814449-55814471 AGCCAGTAAGTAGCAGAGCCAGG - Intronic
1138349204 16:56337560-56337582 AGCCAGTGAGTAGCAGAGCCAGG - Intronic
1138417835 16:56881361-56881383 GGTGAGCAGGAAGCAGAGACGGG - Intronic
1138454652 16:57114328-57114350 GGTGAGGAAGTGGCATTGCCAGG + Intronic
1138536099 16:57661051-57661073 GGTGAGTGAGTGGTAGATCCAGG - Intronic
1138844366 16:60547464-60547486 AGTTAGCAAGTAGCAGAGCCAGG - Intergenic
1139354923 16:66361744-66361766 AGTGTCTGAGTAGCAGAGCCAGG - Intergenic
1139378833 16:66517546-66517568 GGTCTGAAAGTAGCTGAGCCAGG + Intronic
1139979256 16:70840484-70840506 GGGTAGTAACTAGCAGTGCCTGG - Intronic
1140514257 16:75530781-75530803 GGCTAGGAAGTGGCAGAGCCAGG - Exonic
1140740206 16:77934865-77934887 GATGAGTAAGATGCAGGGCCCGG + Intronic
1140749692 16:78012028-78012050 GGTGGTTAAGTTGCAGACCCGGG - Intergenic
1141345651 16:83243059-83243081 GGTGAGTAATTGGTACAGCCAGG + Intronic
1141711120 16:85699499-85699521 GGTAAGTAAGTGGCAGAGGTGGG - Intronic
1142205589 16:88781483-88781505 GATGAGTCAGCAGGAGAGCCTGG - Intronic
1142267126 16:89069685-89069707 AGTCAGTAAGTGGCAGAGCAGGG + Intergenic
1142425470 16:90000117-90000139 GGTGAGTGAGAAGCTGGGCCAGG + Intergenic
1142500939 17:332651-332673 AGTCAGCAAGTCGCAGAGCCTGG - Intronic
1142964589 17:3572606-3572628 GGCTGGTAAGTGGCAGAGCCAGG - Intronic
1143053527 17:4145396-4145418 AGTGAGTTAGAAGCAGAGCTGGG + Intronic
1143184522 17:5002209-5002231 AGTCAGTAACCAGCAGAGCCAGG - Intronic
1143255415 17:5554059-5554081 CGGGAGGCAGTAGCAGAGCCTGG + Intronic
1143310111 17:5980806-5980828 GGTAAGGAAGAGGCAGAGCCAGG - Intronic
1143360421 17:6364796-6364818 AGTGAGTGAGGGGCAGAGCCAGG - Intergenic
1143404294 17:6666909-6666931 GGCTAGGAAGAAGCAGAGCCAGG + Intergenic
1143430667 17:6880888-6880910 GGTGAGTAAGAAGGGGAGCTTGG - Intronic
1144350964 17:14395880-14395902 GGTCTATAAGCAGCAGAGCCAGG + Intergenic
1144456419 17:15422603-15422625 GGTGAGTAAGAAGGAGAGGATGG + Intergenic
1144480833 17:15627784-15627806 GGTGAGTGAGGGGCAGAGCTGGG - Intronic
1144778700 17:17797358-17797380 GGGGAGTCAGGAGCAGAGCCGGG - Exonic
1144917527 17:18736272-18736294 GGTGAGTGAGGGGCAGAGCTGGG + Intergenic
1145103920 17:20099020-20099042 AGTGGGGAAGTGGCAGAGCCAGG - Intronic
1145147704 17:20494966-20494988 GGGGCGTAAATGGCAGAGCCAGG - Intergenic
1145249350 17:21288872-21288894 GGTAAGGAAGTAGTGGAGCCAGG - Intronic
1146052991 17:29567411-29567433 GGTGAGTAAGTCGCAGCTCCGGG + Intronic
1146101903 17:29991123-29991145 GGTGAGTAAGAAGGGGAGCTCGG - Intronic
1146200778 17:30856354-30856376 GGTTAGTAAGTGGCAGAGGTTGG + Intronic
1146521329 17:33527809-33527831 AGTGAGAAAGTGGCAGAACCAGG - Intronic
1146612390 17:34319318-34319340 GCTGAGTAAGCACCAGATCCTGG - Exonic
1146690839 17:34874949-34874971 CCTGAGTAAGTGGCAGTGCCAGG - Intergenic
1146692416 17:34885671-34885693 GGCTAGTGAGTGGCAGAGCCAGG - Intergenic
1146704780 17:34993094-34993116 TGAGAGTTGGTAGCAGAGCCAGG + Intronic
1146794986 17:35774425-35774447 AATGAGTAAGTAGCTGAGGCAGG + Intronic
1146803947 17:35850314-35850336 CTTTAGTAAGTGGCAGAGCCAGG + Intronic
1147456072 17:40538950-40538972 AGTTAATAAGTGGCAGAGCCAGG - Intergenic
1147557825 17:41490641-41490663 GGCAAATTAGTAGCAGAGCCAGG - Intronic
1147790685 17:43012779-43012801 AGCAAGGAAGTAGCAGAGCCAGG - Intronic
1147887203 17:43692102-43692124 AGTTAGTAAGTAGCAGAGCCTGG + Intergenic
1147973735 17:44235719-44235741 AGTGAGTCAGTAGCAGAGGCGGG - Intergenic
1148639523 17:49176069-49176091 GGTGAGTAAGAAGGGGAGCTCGG - Intergenic
1148690807 17:49525750-49525772 AGCTAGTAAGTGGCAGAGCCTGG - Intergenic
1148847020 17:50535340-50535362 GGCACGTAAGTGGCAGAGCCTGG - Intronic
1149336816 17:55644075-55644097 GGCAAGTCAGTAGCAGAGCTGGG - Intergenic
1149349852 17:55775480-55775502 AGACAGTCAGTAGCAGAGCCAGG - Intronic
1149609525 17:57949917-57949939 GGCTAGAAAGTGGCAGAGCCAGG - Intronic
1149995259 17:61402881-61402903 GGTGAGAAAAGAGCAGAGACAGG + Intronic
1150186500 17:63187248-63187270 GGCTAGTAAGTGGCTGAGCCAGG - Intronic
1150904206 17:69319933-69319955 AGTTAGTATGTAGCAGAGGCAGG - Intronic
1151275813 17:73033295-73033317 AGGCAGTAAGTAGCAGATCCAGG + Intronic
1151290101 17:73143633-73143655 TGTTAGTAAGTGGCAGAGCCAGG - Intergenic
1151360135 17:73583826-73583848 TGTAAGTCAGTGGCAGAGCCAGG - Intronic
1151360305 17:73584651-73584673 TGTAAGTCAGTGGCAGAGCCAGG - Intronic
1151702700 17:75751938-75751960 GCTGAGTAAGTGGCAGAGCCAGG - Intronic
1152467363 17:80473908-80473930 GGAGAGGCAGGAGCAGAGCCTGG - Intronic
1152922153 17:83071477-83071499 GGTGAGGAAGGGGCAGATCCTGG + Intergenic
1152938766 17:83154875-83154897 GGTGTGTAGGGAGTAGAGCCAGG - Intergenic
1153029796 18:702959-702981 GGTAAGTAAGCAGAAGAACCAGG + Intronic
1153665742 18:7366646-7366668 AGTTAATAAGTGGCAGAGCCAGG + Intergenic
1153970802 18:10225347-10225369 GGTGAGTAAGAAGGAGAGCTTGG - Intergenic
1154205552 18:12333892-12333914 AGTGGGTAAGCAGCACAGCCAGG - Intronic
1156470761 18:37376069-37376091 GGTTTGTCAGGAGCAGAGCCAGG + Intronic
1156810744 18:41247399-41247421 GATTAGTAAGTAGCAGAGCTGGG + Intergenic
1157182705 18:45511612-45511634 GGTGAGTAAGTGCCATAACCAGG + Intronic
1157634489 18:49137357-49137379 GGTGATTATTTAGCAGAGTCAGG - Intronic
1157672870 18:49545070-49545092 ATTGAGTTAGCAGCAGAGCCAGG + Intergenic
1157746305 18:50138929-50138951 GGTGAGAGAGTTGCAGATCCAGG - Intronic
1158218673 18:55127615-55127637 GGTCAGTAAGTGACAGAGCCAGG + Intergenic
1158499030 18:57983439-57983461 GGGGAGCAAGGAGCAGAGGCTGG + Intergenic
1158640617 18:59200569-59200591 AGCTAGTAAGTAGCAGAGCCAGG - Intergenic
1159026395 18:63185805-63185827 AGCTAGTAAGTAACAGAGCCAGG + Intronic
1159113596 18:64088531-64088553 AGTCAGTAAGTGGTAGAGCCAGG + Intergenic
1159121253 18:64174249-64174271 AGTGAGTAAGTAGTAGAATCAGG - Intergenic
1160446716 18:78933889-78933911 GGTGAGTGTGTAGCACAGCAGGG - Intergenic
1161306289 19:3570654-3570676 GCTGATTAAGCAACAGAGCCAGG + Intronic
1161415957 19:4146467-4146489 GGGGGGCAAGTGGCAGAGCCAGG + Intergenic
1162283238 19:9717322-9717344 GGTGAGTAAGAAGGGGAGCTTGG - Intergenic
1162514028 19:11137691-11137713 AGCGAGTCAGTGGCAGAGCCAGG - Intronic
1162652789 19:12103644-12103666 GGTGAGTAAGAAGGGGAGCTCGG - Intronic
1162849274 19:13418097-13418119 GAACAGTAAGTGGCAGAGCCAGG - Intronic
1163174903 19:15557415-15557437 AGTGAGGGAGTGGCAGAGCCTGG + Intergenic
1163332020 19:16645455-16645477 GGTCTGTAAGTAGCAGAGATCGG - Exonic
1163711267 19:18848499-18848521 GGAGAGGATGGAGCAGAGCCTGG + Intronic
1164789073 19:30960641-30960663 CGTGAGTAAGTGGCAGAGCTGGG + Intergenic
1165866246 19:38941192-38941214 GGTGAGTAAGAAGGGGAGCTCGG - Intronic
1166031735 19:40136274-40136296 GGTGGGTAAATTGCTGAGCCTGG - Intergenic
1166222560 19:41375135-41375157 GGTGAGGAGGAAGCAGAGGCAGG - Intronic
1166326671 19:42054973-42054995 AATGAGAAAATAGCAGAGCCAGG - Intronic
1166374214 19:42318004-42318026 AGTGAGTAAGTGGCAGATTCTGG - Intronic
1166786120 19:45368350-45368372 GGCTAGTAAGTTTCAGAGCCAGG + Intronic
1166942346 19:46374492-46374514 GGCAAGTAAGTAGCAGAGCCAGG + Intronic
1167149410 19:47700138-47700160 AGTTAGTAAGTGGCAGAGCCAGG - Intronic
1167290146 19:48619989-48620011 CATTAGTAACTAGCAGAGCCAGG - Intronic
1167446727 19:49542462-49542484 GTTCAGGAAGTATCAGAGCCAGG + Intronic
1167605229 19:50478404-50478426 CGTGAGTGAGTGGCAGAGCAGGG + Intronic
1167686805 19:50961712-50961734 GCTGTGTAAGTGGCAGATCCGGG + Intronic
925378676 2:3408052-3408074 GATGTGGAACTAGCAGAGCCAGG - Intronic
925777042 2:7346008-7346030 GGTTAGTAAGTGGTAGAGCTAGG + Intergenic
925983277 2:9194079-9194101 GGTGGAAAAGTAGCAGAGCTGGG + Intergenic
926043157 2:9690888-9690910 GGAGTGGAGGTAGCAGAGCCTGG + Intergenic
926232337 2:11013683-11013705 AGGTAGGAAGTAGCAGAGCCAGG - Intergenic
926439379 2:12871882-12871904 GTTGAATAAGTAGCAGACCCAGG - Intergenic
926558949 2:14394072-14394094 GGTTATTAAGTGGCAGAGCCAGG + Intergenic
926736472 2:16077218-16077240 AGCATGTAAGTAGCAGAGCCAGG + Intergenic
926763921 2:16305672-16305694 AGTGACTAAGTAGGAGAGCAGGG + Intergenic
926802777 2:16674712-16674734 GGCAAGTAAGTGGCAGAGCTGGG + Intergenic
926887059 2:17607471-17607493 GGTCAGTGAGTAGGAGAGGCAGG + Intronic
927197840 2:20560282-20560304 GGTGGGTAGGTGGCAGAACCTGG + Intergenic
927427173 2:22994494-22994516 GGTGGGCAAGAAGCAGAACCAGG - Intergenic
927917554 2:26946707-26946729 AGTGTGTAAGTGGCAGAGCCTGG - Intronic
928489379 2:31765663-31765685 AGTTAGTAAGTGTCAGAGCCAGG - Intergenic
928712318 2:34021073-34021095 AGCTGGTAAGTAGCAGAGCCAGG - Intergenic
928875271 2:36031230-36031252 AGTGAGTTAGTGGCAGATCCAGG + Intergenic
929310564 2:40419497-40419519 GGTGAGTAAGAAGGAGAGGTAGG - Intronic
929829057 2:45332954-45332976 GGTGTGTAAAGACCAGAGCCTGG - Intergenic
929855612 2:45636334-45636356 ATCGAGTAGGTAGCAGAGCCTGG - Intergenic
929938564 2:46313178-46313200 GGTCAGTATGTAGCACAGCCAGG - Intronic
930018246 2:46985350-46985372 GGCGTGTAAGTAGCAGTCCCAGG + Intronic
930183168 2:48385132-48385154 GGTGAGTAAGAAGGGGAGCTCGG + Intergenic
930623670 2:53671300-53671322 AGCTAGTAAGCAGCAGAGCCAGG + Intronic
930784037 2:55253076-55253098 AGCCAGTAAGTAGCATAGCCAGG - Intronic
930918153 2:56719622-56719644 GGTGAGTAAGAAGGGGAGCTAGG + Intergenic
931692354 2:64845993-64846015 GTTAAGTAGGTGGCAGAGCCTGG - Intergenic
932211072 2:69930979-69931001 AGGGAGTAAGTGGCAGAGCCAGG + Intronic
932303528 2:70685541-70685563 AGTTGGTAAGTGGCAGAGCCAGG - Intronic
932543326 2:72680264-72680286 AGCTAATAAGTAGCAGAGCCAGG - Intronic
932629358 2:73325135-73325157 GATGAGTCAGGAGCAGAGCCTGG + Intergenic
932641331 2:73450227-73450249 TGTGAGTAAGAAGCAGAGGTTGG - Exonic
932733257 2:74235349-74235371 AGTTAGCAAGGAGCAGAGCCTGG - Intronic
932805359 2:74778420-74778442 GGTGAGAGAAAAGCAGAGCCTGG - Intergenic
933208739 2:79540249-79540271 AGCTAGTAAGTGGCAGAGCCAGG - Intronic
933379380 2:81523787-81523809 GGCTAGTAAGTGGCAGCGCCGGG - Intergenic
933381176 2:81547838-81547860 GGAGAGTAAGTGGCAGAGTTAGG + Intergenic
933438615 2:82281448-82281470 GGTGAGTTAGCAGGAGACCCAGG + Intergenic
933707275 2:85301265-85301287 GGTTAGTAAGTGGCAGAGCTGGG - Intronic
933892233 2:86782553-86782575 AGTTAACAAGTAGCAGAGCCAGG + Intergenic
934859269 2:97750125-97750147 GATCAGTAAATGGCAGAGCCAGG + Intergenic
934993738 2:98938691-98938713 AGATAGTAAGTGGCAGAGCCAGG + Intergenic
935013446 2:99157098-99157120 CATTAGTAAGTGGCAGAGCCAGG + Intronic
935733262 2:106084178-106084200 GGTGAGTTAGGAACAGAGCAGGG + Intergenic
935915794 2:107948022-107948044 GGTGAGTAAGAAGGGGAGCTCGG - Intergenic
936343991 2:111661464-111661486 AGGGAGTGAGTGGCAGAGCCAGG + Intergenic
936973966 2:118201404-118201426 GTTGAGAAAGGAGCAGAGGCTGG - Intergenic
937098348 2:119250072-119250094 AGTCAGTAAGTAGCACAGCTGGG + Intronic
937275375 2:120680661-120680683 ATTAAGTAAGTAGCAGAGCTGGG - Intergenic
937334017 2:121049689-121049711 GGAGAGAAAGCAGCAGAGACCGG - Intergenic
937414385 2:121702721-121702743 TGTGAGTGAGTCACAGAGCCTGG - Intergenic
937486636 2:122322333-122322355 GGCTAGTAAGTAGCAGAGGCAGG + Intergenic
938219008 2:129549556-129549578 GGTCAGTAAGTGGCATAGCACGG - Intergenic
938641806 2:133289025-133289047 ACAGAGTAAGTAGCAGAGTCAGG + Intronic
939853771 2:147331903-147331925 AGTTAGTAAGTAGAAGAGCCAGG + Intergenic
940301549 2:152180801-152180823 GGTGAGTAAGAAGGGGAGCTCGG - Intergenic
940365611 2:152845586-152845608 GGCTGGTAAGTGGCAGAGCCAGG + Intergenic
940413058 2:153388725-153388747 GGTGGGTTAGTTGCAAAGCCAGG + Intergenic
940885315 2:158984792-158984814 GGAGCGTAAGAAGCAGAGGCTGG + Intronic
941174275 2:162177963-162177985 AGTCAGTAAGCAGCAGAGCTGGG + Intronic
942226263 2:173819006-173819028 GGCAAGGGAGTAGCAGAGCCTGG - Intergenic
943043516 2:182830807-182830829 GTTGTGTAAGTAGCAGAGCTGGG - Intergenic
943733907 2:191332703-191332725 AGTGAATAAGTGGCAGAGCTGGG + Intronic
944266793 2:197736049-197736071 GTTGAGTAAGTGGCAGATCCAGG - Intronic
945263048 2:207862721-207862743 GGTGAGTAGGTAGTAGTGACTGG + Intronic
945382609 2:209159468-209159490 AGTGAGTAAGTGGTAGAGCTAGG + Intergenic
946034023 2:216727553-216727575 GGTGAGTCAGAGGCTGAGCCAGG - Intergenic
946215901 2:218183464-218183486 GGTGAGCAGGTACAAGAGCCGGG + Intergenic
946273911 2:218616373-218616395 AGTTAGAAAGTGGCAGAGCCAGG - Intronic
946448372 2:219758962-219758984 AATGAGTTAGTAGCAGAGCCAGG - Intergenic
946808892 2:223501263-223501285 GCTAAGTAAGTGGCAGAACCAGG + Intergenic
947342128 2:229151329-229151351 CGTTAGTAACTAGCAGAGCCTGG - Intronic
947378717 2:229524192-229524214 GATGACAAAGTAGCATAGCCAGG + Intronic
947740769 2:232483867-232483889 GCTGAGTACTTAGCAGGGCCTGG + Intronic
947948882 2:234130438-234130460 AGCTAGTAAGTGGCAGAGCCAGG - Intergenic
948418229 2:237832812-237832834 GGTGAGTAAGTGGCAGAGCCAGG - Intronic
1168876946 20:1178328-1178350 AGCCAGTAAGTGGCAGAGCCTGG + Intronic
1168970476 20:1927439-1927461 AGTGAGTGGGTAGCAGACCCGGG + Intronic
1168978556 20:1986237-1986259 AGTGAGTAAGTGGCAAAGCTGGG + Intronic
1170453292 20:16508283-16508305 GGCTAGTAAGCAGCAGAGCTGGG - Intronic
1170666972 20:18394781-18394803 AGTTAGTAAGTGGCAGACCCAGG - Intronic
1171385552 20:24767401-24767423 TGAGAGTAAGTGGCAAAGCCAGG + Intergenic
1172196674 20:33096682-33096704 GATGAGGCAGTAGCAGAGCTGGG + Intronic
1172208686 20:33182330-33182352 AGTGAGCAAGAGGCAGAGCCAGG + Intergenic
1172355648 20:34277869-34277891 AGTGAGTCAGCAGCAGACCCAGG + Intergenic
1172405402 20:34684916-34684938 GGCTAGTAAGTGGCAGAACCAGG + Intergenic
1172430141 20:34883699-34883721 AGTGAATAAGTGGTAGAGCCAGG + Intronic
1172608597 20:36232335-36232357 GGTGAGTTAGGAGCTGAGCCAGG - Exonic
1172820788 20:37732240-37732262 GTTGAGTAAGGCCCAGAGCCTGG - Intronic
1172858879 20:38031773-38031795 AGTTAGGAAATAGCAGAGCCAGG - Intronic
1173088700 20:39949976-39949998 GACTAGTAAGTGGCAGAGCCTGG + Intergenic
1173138841 20:40464081-40464103 AGCTAGTAAGTAGCAGAGCCAGG - Intergenic
1173192410 20:40886648-40886670 AGTTAGTAAGTGGGAGAGCCTGG - Intergenic
1173560638 20:44003011-44003033 AGGCAGTAAGTGGCAGAGCCAGG + Intronic
1173849875 20:46211021-46211043 AGTGAGTCCCTAGCAGAGCCAGG + Intronic
1173909266 20:46651803-46651825 AGTGAGTAAGTGGCCGTGCCAGG - Intronic
1173923506 20:46763453-46763475 GGGAAGTTAGTAGAAGAGCCAGG + Intergenic
1174176350 20:48647697-48647719 AGTGGATAAGTAGCAGGGCCAGG + Intronic
1174224532 20:48986285-48986307 AGCTAGTAAGGAGCAGAGCCAGG + Intronic
1174550921 20:51360863-51360885 AGCGAGTAAGTGGCAGAGCCAGG - Intergenic
1174606287 20:51764210-51764232 AGCTAGTAAGCAGCAGAGCCTGG + Intronic
1175053240 20:56174360-56174382 GGCTAGGCAGTAGCAGAGCCAGG - Intergenic
1175115193 20:56677080-56677102 GGCCAGTAAGCAGCAGAGCTGGG + Intergenic
1175502596 20:59461013-59461035 AGCGAGAAAGTGGCAGAGCCAGG + Intergenic
1175539293 20:59738202-59738224 TGTTAGTAAGTGGCAGGGCCAGG + Intronic
1176632589 21:9153703-9153725 GGTGAGTAAGAAGGGGAGCTCGG - Intergenic
1178015923 21:28346095-28346117 GGAGAGGAAGTAGCTGAGCAAGG - Intergenic
1178076375 21:29016778-29016800 AGTTGGTAAGTGGCAGAGCCAGG - Intronic
1178822298 21:35986536-35986558 GATGAGTGAGTGGCAGAACCAGG + Intronic
1181054385 22:20253179-20253201 GGTGGGTTTGTAGCACAGCCTGG - Intronic
1181769195 22:25113204-25113226 AGTGAGTGAGTGGCAGAGCCAGG + Intronic
1181999880 22:26911584-26911606 GGCCAGTAAGTGGCAGAGCTGGG - Intergenic
1182176639 22:28296882-28296904 AGCTAGTAAGTGGCAGAGCCAGG + Intronic
1182486957 22:30645165-30645187 GGCTAGTAAGTGGCAGAGCTGGG + Intronic
1182507256 22:30792956-30792978 AGTTAGTAAATGGCAGAGCCTGG + Intronic
1182799440 22:33019412-33019434 CATGAGTAAGTGGCAGAGCTGGG - Intronic
1182827878 22:33281474-33281496 AGCCAGTAAATAGCAGAGCCTGG - Intronic
1182992723 22:34783358-34783380 GGATATTCAGTAGCAGAGCCTGG + Intergenic
1183573480 22:38671780-38671802 AGTTAGTCAGTAGCAGAGCTGGG - Intronic
1183711105 22:39503970-39503992 GGCAAGTAAGTGGCAGGGCCAGG + Intronic
1183816068 22:40301523-40301545 GGTTACTAAATAGCAGAGCCAGG + Intronic
1184088467 22:42280013-42280035 GGTGAGTTACTAGCAGGGACAGG + Intronic
1184207809 22:43015932-43015954 AGAGAGTAAATGGCAGAGCCAGG + Intergenic
1184275206 22:43405935-43405957 AGAGAGTAAGTTGCAGAGCCTGG - Intergenic
1184292082 22:43502757-43502779 GGTCAGTACGTAGCGGAGACAGG + Exonic
1184430469 22:44439164-44439186 AGTGAGTAAACAGCAGAGCTGGG - Intergenic
949152285 3:784027-784049 TGTGAATAAGTGGCACAGCCAGG + Intergenic
949164605 3:923652-923674 AGTTAATAAGTAGTAGAGCCAGG + Intergenic
949261033 3:2103115-2103137 AGCTAGTAAGTAGCAGAGCTGGG + Intronic
949438799 3:4057950-4057972 GTTGAGAAAGTGGCAGAGCAGGG + Intronic
949483007 3:4511710-4511732 AGTGAGTAAGTGGCAGAGCTGGG + Intronic
949598321 3:5571840-5571862 GGGGAGGAAGTGGCAGAGCTGGG + Intergenic
950091759 3:10300687-10300709 AGAGGGTAAGTAGCAGACCCAGG + Intronic
950231569 3:11280435-11280457 GGCTAGAAAGTAGCAGAGACAGG + Intronic
950897026 3:16462108-16462130 AGCTAGTAAGTGGCAGAGCCAGG - Intronic
951044367 3:18021972-18021994 AGTTAGTTAGTAGCTGAGCCAGG - Intronic
951082827 3:18472073-18472095 GGTAAGTGATTAGCAAAGCCAGG - Intergenic
951270689 3:20619842-20619864 GGTGAGTAAGAAGGGGAGCTTGG - Intergenic
951323474 3:21275032-21275054 GCTTAGTAAGTGGCAGAGCTAGG - Intergenic
951339322 3:21465671-21465693 GGAAAGGAAGAAGCAGAGCCAGG - Intronic
951356674 3:21675483-21675505 AGTTAGTAAGTGGTAGAGCCAGG + Intronic
952142918 3:30499617-30499639 GGTGAGGAAGGAGCAGAGCTGGG - Intergenic
952437616 3:33287705-33287727 AGTTAGTGAGTGGCAGAGCCAGG + Intronic
952820903 3:37484736-37484758 TAAGAGGAAGTAGCAGAGCCGGG - Intronic
953263410 3:41362556-41362578 GCTGAGTAAGTGGTGGAGCCAGG - Intronic
953564075 3:44016087-44016109 AGTGAGCAAGTGGCACAGCCAGG - Intergenic
953680838 3:45036786-45036808 AGCTGGTAAGTAGCAGAGCCGGG + Intergenic
954231293 3:49219761-49219783 GGTGAGTAAGAAGGGGAGCTCGG + Intronic
954925730 3:54232627-54232649 GGTAAGAAAGGAGCAGACCCTGG - Intronic
954929481 3:54268774-54268796 AGCTAGTAAGTGGCAGAGCCGGG + Intronic
955155347 3:56411751-56411773 GGCTGGTGAGTAGCAGAGCCAGG + Intronic
955204875 3:56886847-56886869 GATTAGCAAGTGGCAGAGCCTGG + Intronic
955398666 3:58575534-58575556 AGAGAGTAAGCAGCAAAGCCAGG + Intronic
955421663 3:58744275-58744297 GGTGAGTTAGAGGCAGAGCTGGG + Intronic
955440211 3:58947018-58947040 AGATAGTACGTAGCAGAGCCAGG + Intronic
955512887 3:59698849-59698871 GGTGAGAAAGAAGTAGAGCCAGG - Intergenic
955626303 3:60923295-60923317 GTTTAGCAAGTAGCAGAGGCAGG - Intronic
955693634 3:61614304-61614326 GGTTGGTTAGTAGCACAGCCAGG - Intronic
956058686 3:65327919-65327941 GGCTAGTACGTGGCAGAGCCAGG - Intergenic
957476516 3:80732291-80732313 AGTAAGTGAGTAGCAGAGCTTGG - Intergenic
958988023 3:100805652-100805674 GGTTATTAAGTACCAGAGTCAGG + Intronic
959134226 3:102396895-102396917 GGTTAGTAAGTAGTGGGGCCAGG - Intronic
959160207 3:102714922-102714944 GGTTAGGAAGTGGCAGAGCTTGG - Intergenic
959197890 3:103209558-103209580 GGTGAGTAAGAAGGGGAGCTTGG + Intergenic
960137962 3:114124569-114124591 AGTCAGTAAGTGGCAGAGCATGG - Intergenic
960907907 3:122620094-122620116 GCTCAGTAAATGGCAGAGCCTGG - Intronic
960959450 3:123059321-123059343 AGCTAGTAAGTGGCAGAGCCAGG + Intergenic
960962524 3:123082334-123082356 AGTAGGTAAGTAACAGAGCCAGG - Intronic
961122171 3:124382066-124382088 GGCCAGTAAGTGGCAGAACCAGG - Intronic
961152912 3:124654747-124654769 GCAAAGTGAGTAGCAGAGCCAGG - Intronic
961214927 3:125152008-125152030 ATTGAGAAAGTGGCAGAGCCAGG + Intronic
961604701 3:128085019-128085041 GGAGAGTAAGCAGCAGAGCCAGG - Intronic
961673413 3:128550586-128550608 GGTGAGTGAGAAGGAGAGCGGGG + Intergenic
961859297 3:129901860-129901882 GGTGAGTAAGAAGGGGAGCTCGG + Intergenic
962105623 3:132385824-132385846 GGCTAGTAAGTGGCAGAGCTGGG - Intergenic
962223202 3:133581628-133581650 GGCTGGTAAGTGGCAGAGCCTGG + Intronic
962445509 3:135460036-135460058 ATTGAGTAAGTAGAGGAGCCAGG - Intergenic
962477939 3:135773193-135773215 AGGTAGTAAGTGGCAGAGCCAGG + Intergenic
962909488 3:139835172-139835194 GGAAAAGAAGTAGCAGAGCCAGG + Intergenic
963219749 3:142796173-142796195 GGTTGGTAAGTAGCAGAACTGGG + Intronic
963837003 3:150067934-150067956 GGTGAGGAAGTAGCATGGACAGG + Intergenic
964468366 3:157023687-157023709 AGTTAGGAAGTAGCAGAGCCAGG + Intronic
964527935 3:157635283-157635305 AGCTAGTACGTAGCAGAGCCTGG + Intronic
964638485 3:158883783-158883805 AGTTAGTAAGCAGCAGAGCTAGG - Intergenic
964742936 3:159986674-159986696 AGCAAGTAAGTAGCAGAACCTGG + Intergenic
965315322 3:167183288-167183310 GGTGAGTAAGAAGGGGAGCTTGG - Intergenic
965385832 3:168045450-168045472 TTTCATTAAGTAGCAGAGCCAGG + Intronic
965507311 3:169530677-169530699 AGTCAGTAAGTAGCAGAACTGGG - Intronic
966412736 3:179659683-179659705 AGAGAGTAAGTAGGAGAGCTGGG + Intronic
966492128 3:180539693-180539715 GGTTAGTAAGTGGCAGAATCAGG - Intergenic
966851156 3:184165864-184165886 AGCCAGTAAGTGGCAGAGCCAGG - Intronic
966968434 3:185019157-185019179 GGTGAGTAAGAAGGGGAGCTTGG - Intronic
966978285 3:185105825-185105847 GGTGAGTAAGAAGGGGAGCTTGG + Intronic
967248832 3:187516247-187516269 GGTGACTAATTGGCACAGCCAGG + Intergenic
967323895 3:188220063-188220085 AGTGAGGAAGTATCACAGCCGGG - Intronic
967378293 3:188829758-188829780 GGTGAGTAAGTAGCCAAGCTGGG - Intronic
967512833 3:190332508-190332530 GGTGAGTAAGTGGCTATGCCAGG - Intronic
967981819 3:195070309-195070331 GGTGAGGACGTAGCAGAGGATGG - Intronic
968859272 4:3153370-3153392 AGTGAGTAAGTAGCAGAGCTAGG + Intronic
969363396 4:6679621-6679643 GGTGAGTAATCAGCACAGCCAGG - Intergenic
969555516 4:7906201-7906223 GGTGAATGAGTCGCAGAGCTGGG - Intronic
970627697 4:17907423-17907445 CTTAAGTAAGTAGCAGAGCTGGG + Intronic
970650503 4:18172191-18172213 AGCTAGTAAGTAGCAGAGCTGGG - Intergenic
970898900 4:21135775-21135797 AGCCAGTAAGTGGCAGAGCCTGG - Intronic
971188359 4:24402755-24402777 GGTGAGTAGGGAGCAGAGTGAGG - Intergenic
971260357 4:25051394-25051416 GGTGAGAAAATAGCAAATCCAGG + Intergenic
971260838 4:25055394-25055416 AGCTAGTAAGTAGCAGACCCAGG + Intergenic
971396292 4:26230543-26230565 AGTGAATAAGTGGCAGAGCCAGG + Intronic
971467388 4:26977888-26977910 GGTGAGATAGGAGGAGAGCCAGG + Intronic
972378941 4:38500790-38500812 GCTAATTAAGTGGCAGAGCCTGG - Intergenic
972954588 4:44373429-44373451 AGTGAGTGAGTTGCAGAGCTGGG - Intronic
972969584 4:44556461-44556483 AGTTAGTAAGCAGCACAGCCTGG + Intergenic
972995513 4:44874099-44874121 GGTTAGTAAATGGCAGAGCCAGG + Intergenic
973259923 4:48152660-48152682 AGCTAGTAAGTAGCAGAGCCAGG + Intronic
973594635 4:52474246-52474268 CTGGAGTAAGTAGCAGAGTCAGG - Intergenic
975489294 4:74970899-74970921 AGTGAAGAAGGAGCAGAGCCAGG - Intronic
975691909 4:76973710-76973732 AGCAAGTAAGTAACAGAGCCTGG - Intronic
976113407 4:81701056-81701078 AGTTAGTAAGTGGCAGAGACAGG - Intronic
976146956 4:82051446-82051468 GGTAAGGAAGCATCAGAGCCAGG + Intergenic
976225612 4:82793805-82793827 GGTAAGTAAGTAGAAGAGCAGGG + Intronic
976335302 4:83878740-83878762 AGAGGGTAATTAGCAGAGCCAGG + Intergenic
976557007 4:86461526-86461548 GGTGAGTAAGAAGGGGAGCTTGG + Intronic
976776351 4:88710441-88710463 AGCTAGTAAATAGCAGAGCCAGG - Intergenic
976977894 4:91186381-91186403 GGTGAGTAAGAAGGGGAGCTCGG - Intronic
977247103 4:94645492-94645514 GGTGGTTAAATAGTAGAGCCAGG + Intronic
977352495 4:95906075-95906097 GATAAGTAAGTAGTAGACCCAGG - Intergenic
977443733 4:97101981-97102003 GGTGAGTAAGAAGGGGAGCAGGG - Intergenic
977641975 4:99367674-99367696 GGTGAGTAAGAAGGGGAGCTCGG + Intergenic
977737115 4:100430254-100430276 AGTAAGTAGGTGGCAGAGCCAGG + Intronic
977807916 4:101324290-101324312 GGCAAATAAGCAGCAGAGCCAGG + Intronic
978424100 4:108564093-108564115 AGCTAGTAAGTAGCAGAGCCGGG + Intergenic
979809811 4:125022311-125022333 GGAGAGTAAGGGGCAGAGACAGG + Intergenic
980092863 4:128460375-128460397 AGAAAGTAAGTAGCAGAGCTGGG + Intergenic
980244070 4:130215044-130215066 GGCAAATAAGTGGCAGAGCCAGG - Intergenic
981266630 4:142791791-142791813 GGTGAGTAAGTAGCAGAGCCTGG - Intronic
981573395 4:146177189-146177211 GCTAATTAAGTAGCAGAGCTGGG + Intronic
982101624 4:151974030-151974052 GGTGAGTAAGAAGCAGTGTCAGG - Intergenic
982282077 4:153693785-153693807 GGTGAGTAAGAAGGGGAGCTCGG - Intergenic
982724696 4:158893293-158893315 GGTTAGGAAGTAGCAGAACTTGG - Exonic
983489763 4:168374925-168374947 GGTTAATAAGTAGCAGAGCCAGG + Intronic
983976963 4:173946304-173946326 TGTGAGTAAATGGCAGAGCCAGG - Intergenic
983994227 4:174161357-174161379 AGGTCGTAAGTAGCAGAGCCAGG - Intergenic
984169630 4:176344359-176344381 GGTGAGTAAGAAGGGGAGCTCGG + Intergenic
984260649 4:177441033-177441055 AGCTGGTAAGTAGCAGAGCCAGG + Intronic
985560952 5:585487-585509 AGTGAGTGAGTGACAGAGCCAGG - Intergenic
985736168 5:1584755-1584777 GGTGAGTAAGAAGGGGAGCTCGG - Intergenic
986451243 5:7868428-7868450 GGTGGTTAAGTGGCAGAGCTAGG + Intronic
986630461 5:9767413-9767435 AGTGAGTAAGTGGCAGAGCCAGG - Intergenic
987574035 5:19703305-19703327 GGTGAGTAAGAAGGGGAGCTTGG + Intronic
989081972 5:37631907-37631929 GGTGAGTGGGGAGGAGAGCCAGG + Intronic
989088072 5:37696968-37696990 AGTTAGTAAGTAGTAGAGCTGGG - Intronic
990307149 5:54504784-54504806 GGTGAGTAAGAAGGGGAGCTCGG - Intergenic
990440292 5:55837775-55837797 GGTGAGGCAGGAGGAGAGCCAGG + Intergenic
990479582 5:56196557-56196579 GGCTAGTAAGTAACAGAGGCAGG + Intronic
990488799 5:56284186-56284208 GGTTAGTTAGTGACAGAGCCAGG - Intergenic
990522092 5:56590046-56590068 AGTGAGCAAGTAGCAGGACCAGG + Intronic
991055136 5:62311960-62311982 GGTTAATAAGGAGCATAGCCTGG + Intronic
991284845 5:64961223-64961245 TGTGAGTTATCAGCAGAGCCTGG - Intronic
991915130 5:71597930-71597952 AGTAAGTAAGGGGCAGAGCCGGG - Intronic
992032735 5:72739243-72739265 GCTGTGTAAGGAGCAGAGCTGGG + Intergenic
992092360 5:73328618-73328640 AGTTAGTAAGTGGCAGAGCCAGG - Intergenic
992149433 5:73888144-73888166 GGTTAGTAAGTGGGAGAGCAGGG - Intronic
992958010 5:81930256-81930278 GGTGTAAAAGTAGCAGAGCATGG + Intergenic
992981032 5:82172326-82172348 GGTTAGTAAGCAGCAGAGCTAGG - Intronic
992993713 5:82312076-82312098 GGAGAGTAAGTGTCAGAGCTGGG - Intronic
993543961 5:89188105-89188127 GGTTAATAAGTGACAGAGCCAGG + Intergenic
993675206 5:90808326-90808348 AGCGAGTAAGTGGCAGAGCCAGG - Intronic
993701386 5:91123061-91123083 GACTAGCAAGTAGCAGAGCCAGG - Intronic
993837811 5:92836168-92836190 GCTGAGTAAGTTGCAGAGGTGGG - Intergenic
994090281 5:95803693-95803715 GGTTAATAAGTGGCAGAGCTGGG + Intronic
995260683 5:110100754-110100776 AGAGAGCAAGTGGCAGAGCCAGG - Intergenic
995644693 5:114298395-114298417 GCTGAGTGAGGAGAAGAGCCGGG - Intergenic
995653171 5:114394940-114394962 GGAAAGTAAGTAGAATAGCCAGG - Intronic
996038271 5:118782607-118782629 GGTTAATAGGTAGCAGAGACAGG - Intergenic
996291808 5:121860318-121860340 GGTGAGTAAGAAGGGGAGCTCGG - Intergenic
996517815 5:124392737-124392759 TGTCAGTAAGTGGCAGAGCCAGG - Intergenic
996703914 5:126477787-126477809 GGTGAGTATGCAGCCGAGCGAGG + Exonic
997248465 5:132370699-132370721 GGGTGGTAAGTAGCAGAGCCAGG + Intronic
997276331 5:132595167-132595189 AGTGAGTAAGTTGTAGAGCCAGG - Intronic
997615459 5:135243294-135243316 GGCTAGTGAGTGGCAGAGCCAGG - Intronic
997704596 5:135936062-135936084 GGTTAGTAAGTAGCAGAGTAGGG + Intronic
997737868 5:136227739-136227761 AGCTAGTAAGGAGCAGAGCCAGG - Intronic
997766110 5:136505338-136505360 AGTGAATAAGTGGCAGGGCCAGG - Intergenic
997785488 5:136708511-136708533 AGCTAGTAAGAAGCAGAGCCAGG + Intergenic
997830246 5:137143491-137143513 GGTTAGCAAGCAGCAGAGGCAGG - Intronic
998135462 5:139671907-139671929 GGTCAGTAAGTGGCAGAGCCAGG - Intronic
998158181 5:139797777-139797799 GGTTAGTAAGTGGCAGAGTGAGG + Intronic
998165994 5:139844228-139844250 GGTGAGTGGAGAGCAGAGCCAGG + Exonic
998524227 5:142827685-142827707 AGAGGGTAAGCAGCAGAGCCAGG - Intronic
998525132 5:142835979-142836001 AGTTAGTAAATGGCAGAGCCAGG + Intronic
998761299 5:145434921-145434943 AATGAGTAAGTGGAAGAGCCAGG - Intergenic
998882667 5:146659430-146659452 GGTTGGTAATTAGCACAGCCAGG - Intronic
999141158 5:149363016-149363038 AGTGAGTTAGTTGCAGAGCCGGG + Intronic
999338167 5:150742503-150742525 GGAGAGTAAGTGGTAAAGCCAGG + Intronic
999379061 5:151107378-151107400 AGTGAGTAAGTGGCAGAGCAGGG + Intronic
999381405 5:151123971-151123993 GGTGAGTCAGCAGCAGAGCCAGG + Intronic
999460237 5:151751400-151751422 GGTCAGTAAATGGCAGAGCTGGG - Intronic
999498784 5:152125977-152125999 TCTGAGGAAGTAGCAGGGCCTGG - Intergenic
999671764 5:153964788-153964810 GCTGGGTATGTGGCAGAGCCAGG - Intergenic
999721670 5:154403158-154403180 AGTGGGTAAGTGGCTGAGCCAGG + Intronic
999721685 5:154403230-154403252 AGTGGGTAAGTGGCTGAGCCAGG + Intronic
999726330 5:154441258-154441280 GGCTAGTCAGTGGCAGAGCCAGG + Intergenic
1000050739 5:157561028-157561050 AGGTAGTAAGTGGCAGAGCCAGG + Intronic
1000251511 5:159500097-159500119 AGTGAGAAAGTAGCAAAGCTGGG + Intergenic
1000383817 5:160654638-160654660 GGTTGGTAAGTAACAGAGTCAGG + Intronic
1000605775 5:163326157-163326179 AGTTAGTAAGTAGTAGAGCCAGG + Intergenic
1000619595 5:163468718-163468740 GGTAAGTGAGTGGTAGAGCCAGG + Intronic
1000742553 5:164987504-164987526 GGTGAGCGAGTACCAGGGCCTGG - Intergenic
1000875952 5:166638540-166638562 AGATAGTAAGTAGTAGAGCCAGG + Intergenic
1000926160 5:167197212-167197234 AGTTAATAAGTGGCAGAGCCAGG + Intergenic
1000946654 5:167430234-167430256 GGGAAGTAAGTGGCAGAGTCAGG - Intronic
1001124669 5:169008562-169008584 GGGAAGTCAGTAGCTGAGCCGGG - Intronic
1001303846 5:170557099-170557121 AGTTAGTAAGTGGCAGAGCTGGG - Intronic
1001555484 5:172634126-172634148 AGTTAGTAAGTAGCCAAGCCAGG + Intergenic
1001717616 5:173829411-173829433 AGCTAGTAAGTGGCAGAGCCGGG - Intergenic
1001752638 5:174143204-174143226 AGTGAGTAAGCCACAGAGCCAGG - Intronic
1001768402 5:174273298-174273320 GGAGAGTAAGAAACAGAGCCAGG + Intergenic
1002053916 5:176587594-176587616 GGTCAGTAAGAAGCCCAGCCAGG - Intronic
1002123627 5:177024491-177024513 AGTGTGAAAGTAGGAGAGCCGGG - Intronic
1002200779 5:177526756-177526778 GGCTAGGAAGTGGCAGAGCCAGG + Intronic
1002720618 5:181259300-181259322 AGACAGTAAGTGGCAGAGCCAGG + Intronic
1002850925 6:995717-995739 GCTGAGTGAGCAGCAGAGCTGGG + Intergenic
1002946976 6:1771365-1771387 AGTCATTAAGTAGCAGAGCTGGG - Intronic
1003231790 6:4260503-4260525 AGTCAGTAAATATCAGAGCCAGG - Intergenic
1003433890 6:6067972-6067994 GGTGAGTAAGAAGGGGAGCTTGG - Intergenic
1004029074 6:11848181-11848203 GGTGAGTTAGGGACAGAGCCAGG - Intergenic
1004122589 6:12839114-12839136 GGCTAGCAAGTAGCAGGGCCTGG + Intronic
1004186235 6:13423661-13423683 AGTGAGTCGGTAGCAGAACCGGG + Intronic
1004276232 6:14237572-14237594 AGGTAGTAAGTAGCAGAGCCAGG - Intergenic
1005343689 6:24868296-24868318 AGTGAGTAGGTGGCAGAGCTGGG + Intronic
1006374712 6:33665503-33665525 AGTTAGTAAGTGGCAGAGTCAGG + Intronic
1006602634 6:35236022-35236044 AGTTAGAAAGTAACAGAGCCAGG - Intronic
1006615303 6:35321910-35321932 AGTTAGTAAGTAGCAAAGCCAGG - Intergenic
1006702682 6:35988692-35988714 CATTAGTAAGTAGCAGAGCTAGG - Intronic
1006717929 6:36131895-36131917 GGTTAGTCAGTAGCAGAGCTGGG + Intronic
1007198192 6:40081584-40081606 GATGAGTAAGAAGCAGTGCCAGG - Intergenic
1007248374 6:40478648-40478670 GGTTGGTCAGTAGCTGAGCCAGG + Intronic
1007419746 6:41712432-41712454 GGCTAGTGAGAAGCAGAGCCGGG - Intronic
1007432216 6:41783252-41783274 AGCTAGTAAGTGGCAGAGCCAGG - Intronic
1007567154 6:42860631-42860653 GCAGAGTAATTAGCAGAGCTCGG + Intronic
1007836238 6:44676238-44676260 AGGTAGCAAGTAGCAGAGCCAGG + Intergenic
1007922246 6:45620911-45620933 AGCAAATAAGTAGCAGAGCCTGG - Intronic
1007990512 6:46250615-46250637 GGACAGTCAGTAGCAGAGCCAGG + Intronic
1008029523 6:46678398-46678420 AGTGACTTAGTAGCAGAGCCAGG + Intergenic
1008453426 6:51679956-51679978 AGAGGGTAAGAAGCAGAGCCAGG - Intronic
1008505224 6:52223700-52223722 GGTGAGGAAGTAGAAGTGACAGG - Intergenic
1009040990 6:58177062-58177084 TATTAGTAAGTAGCACAGCCAGG - Intergenic
1009216851 6:60931594-60931616 TATTAGTAAGTAGCACAGCCAGG - Intergenic
1010838499 6:80618676-80618698 TGGCAGTAAGAAGCAGAGCCAGG + Intergenic
1011477622 6:87763525-87763547 GGTGAGTAGGTAGGAGAGATGGG + Intergenic
1011663242 6:89612026-89612048 AGTTAGTAAGTTGCAGAGCCAGG + Intronic
1012269632 6:97192914-97192936 TCTTAGTAAGCAGCAGAGCCAGG + Intronic
1012985771 6:105874943-105874965 AGTGAGTCAGAAGCAGAGTCTGG - Intergenic
1013234448 6:108184672-108184694 GGTGAGTGAGGAGGGGAGCCTGG + Intronic
1013635573 6:112026315-112026337 AGTTAGTAAATGGCAGAGCCAGG + Intergenic
1013732386 6:113184113-113184135 GGTGAGTAAGTAGCATGAGCAGG + Intergenic
1015542769 6:134332653-134332675 TGCTAGTAAGTAGCAGGGCCGGG - Intergenic
1017491092 6:154945551-154945573 AGTCAGTAAGTTGTAGAGCCAGG - Intronic
1018517888 6:164607720-164607742 GGTGAGTAATTGGTAGAGCCAGG + Intergenic
1018829103 6:167428902-167428924 AGTGAGTAGGTAACAGAGCTGGG + Intergenic
1019689171 7:2400403-2400425 GCTGTGTAAGTGACAGAGCCAGG - Intergenic
1020345752 7:7161677-7161699 AGTTAGTAAATAGTAGAGCCAGG + Intronic
1020730009 7:11868748-11868770 AGTGGGTAATAAGCAGAGCCTGG + Intergenic
1021129175 7:16890466-16890488 TCACAGTAAGTAGCAGAGCCTGG + Intergenic
1021988404 7:26119355-26119377 TGTTAGTAAGTGGCAGAGCTGGG + Intergenic
1022203233 7:28137979-28138001 GGTAAGTAAGTGGCAGAGCCAGG + Intronic
1022233416 7:28437327-28437349 AGTTATTAAGTTGCAGAGCCAGG + Intronic
1022975782 7:35555459-35555481 GATCAGTAAGTGGCAGAGCCAGG + Intergenic
1023122238 7:36921319-36921341 AGCTAGTAAGTGGCAGAGCCAGG - Intronic
1023281546 7:38575822-38575844 TGAAAGTGAGTAGCAGAGCCTGG - Intronic
1023501184 7:40851106-40851128 AGTCAGTAAATGGCAGAGCCAGG + Intronic
1023521710 7:41056213-41056235 GGCTAGTAAGTGGCAGAGCCAGG - Intergenic
1024102284 7:46044529-46044551 GGTGAGTAAGAAGGGGAGCTTGG - Intergenic
1024911219 7:54449467-54449489 GGTGAGTAAGAAGGGGAGCTCGG + Intergenic
1024991484 7:55237830-55237852 CATTAGTGAGTAGCAGAGCCTGG - Intronic
1025122559 7:56317557-56317579 GGTGAGTAAGAAGGGGAGCTCGG + Intergenic
1025683942 7:63701180-63701202 GGTGAGTAAGAAACAGTTCCAGG + Intergenic
1026590907 7:71694765-71694787 AATCATTAAGTAGCAGAGCCTGG + Intronic
1026937023 7:74263402-74263424 GGTGGGTAGGAAGCAGATCCTGG + Intergenic
1026957599 7:74387551-74387573 GGTGAACAAGAAGCAGGGCCAGG - Intronic
1027976558 7:85164124-85164146 AGTCAGTCAGTAGCAGAGCATGG + Intronic
1028124830 7:87100764-87100786 AGACAGTAAGTAGCAGACCCAGG + Intergenic
1028672718 7:93421858-93421880 AGTTAGTAAGTAGCTGAGCTAGG - Intergenic
1029276891 7:99410897-99410919 AGCGGGTAAGTAGCAGAGCCAGG + Intronic
1029361170 7:100089436-100089458 GGTGAGCAAGGAGAAGAGACTGG - Intronic
1030131003 7:106200306-106200328 GACGAGTAAGTAGCAGAGCTGGG + Intergenic
1030281633 7:107782078-107782100 AGATAATAAGTAGCAGAGCCAGG + Intronic
1030806075 7:113921026-113921048 AGCTAGTAAGCAGCAGAGCCAGG - Intronic
1030831931 7:114234677-114234699 AGCTAGTTAGTAGCAGAGCCAGG + Intronic
1031162707 7:118187691-118187713 GGGTAGTAAGTGGCAGAGCCAGG - Intronic
1032056207 7:128686444-128686466 AGGTAGTAAGTAGCAGAGCCAGG + Intronic
1032473533 7:132196197-132196219 AGTAAGTAAGTGGCAGAGCCAGG + Intronic
1032731759 7:134650101-134650123 TGTCAGTCAGTAGCAGAGCTGGG + Intronic
1032754287 7:134873700-134873722 AGTTAGTAAGTGGCAGAGCTGGG - Intronic
1034415110 7:150960178-150960200 AGTGATTAAGCAGCAGATCCGGG - Intronic
1034690743 7:153011667-153011689 GGTGATTAAGGGGCAGAGCTTGG + Intergenic
1034823505 7:154238592-154238614 GGCTAGGAAGTAGCAGAGCTGGG + Intronic
1035746090 8:1962876-1962898 GGTTAGAAAGTGGCAGAGCTAGG + Intergenic
1035989078 8:4468193-4468215 GTTGAGAAAGCAGCAGTGCCTGG + Intronic
1036220248 8:6915237-6915259 GATGAGTGACTAGCAAAGCCTGG + Intergenic
1036410002 8:8491079-8491101 AGCTAGTAAGTGGCAGAGCCAGG + Intergenic
1036632782 8:10526904-10526926 CGTGAATAAGCAACAGAGCCTGG + Intronic
1036934385 8:12987160-12987182 AGCTAGTAAGTGGCAGAGCCAGG - Intronic
1037340609 8:17840586-17840608 GGCCAGTAAGTAATAGAGCCAGG + Intergenic
1037551980 8:19983383-19983405 AATTAGGAAGTAGCAGAGCCAGG - Intergenic
1037562474 8:20087310-20087332 AGTGAGTTGGTAGCAGAGCTGGG - Intergenic
1037675954 8:21050859-21050881 TGAGAGCAAATAGCAGAGCCGGG - Intergenic
1038173601 8:25161200-25161222 AGGTAGTAAGTGGCAGAGCCAGG + Intergenic
1038510429 8:28129336-28129358 AGTTAGGAAGTAGCAGAGCCAGG + Intronic
1038531670 8:28322811-28322833 GGTTTATAAGTAGCAGAGCCAGG - Intronic
1039018506 8:33180076-33180098 AGTGAGTAAGTAGAGAAGCCAGG - Intergenic
1039064299 8:33595848-33595870 GGGTTGTAAGTAGCAGAGCCCGG - Intronic
1039181872 8:34876088-34876110 GGTTAGTAAGTGGTAGAGCAGGG + Intergenic
1039318765 8:36404640-36404662 AGGTAGTAAGTAGCAGAGCCAGG + Intergenic
1039914636 8:41850848-41850870 GGCTAGTAAGTGGCTGAGCCAGG + Intronic
1040803745 8:51371208-51371230 GATGAGTAAGTGGTGGAGCCAGG - Intronic
1041023183 8:53658517-53658539 GGTGAGCGAGGGGCAGAGCCAGG + Intergenic
1041166734 8:55099624-55099646 GGCCAGTAATTAGCAAAGCCTGG + Intergenic
1042446310 8:68889266-68889288 GGTGAGTAAGAAGGGGAGCTTGG + Intergenic
1043024070 8:75044678-75044700 GGTGAGTAAGAAGGGGAGCTCGG + Intergenic
1044442343 8:92237167-92237189 GGTGAGTAAGAAGGGGAGCTCGG + Intergenic
1044752715 8:95431481-95431503 GGTGAGGAAGAGGCAGTGCCAGG + Intergenic
1045017460 8:98011472-98011494 GGGGAGTCAGTGGCAGAGCCAGG + Intronic
1045089779 8:98729811-98729833 AGGTAGTATGTAGCAGAGCCAGG + Intronic
1045098577 8:98823812-98823834 GCATAATAAGTAGCAGAGCCAGG + Intronic
1045174499 8:99707218-99707240 GGTCAGTAAGTAGCAGGGCTGGG - Intronic
1045287827 8:100807220-100807242 GGTGAGTCAGAAGTAGAGCAGGG + Intergenic
1046660827 8:116946781-116946803 AGTTGGTAAGTGGCAGAGCCAGG - Intergenic
1046729570 8:117710652-117710674 GGCTAGTAAGTGGCAGAGCCAGG + Intergenic
1046855818 8:119030547-119030569 GATGAGTCAGTAGTAGAACCAGG - Intronic
1047281196 8:123447588-123447610 AGCCAGTAAGTAGTAGAGCCAGG + Intronic
1047431799 8:124799237-124799259 TGTTAGTAAATAGCAGAGCCAGG - Intergenic
1047460697 8:125061922-125061944 GGTGACTAAATGGCAGAGCCAGG + Intronic
1047562867 8:126008343-126008365 GGTGAGTAAGAAGGGGAGCTTGG + Intergenic
1048442054 8:134467296-134467318 GATGAGGTAGTAGCAAAGCCAGG - Intergenic
1048568868 8:135633263-135633285 AGTTGGTAAGTGGCAGAGCCAGG + Intronic
1048995810 8:139793103-139793125 GCTTAGTAAGTGGCAGAGGCTGG - Intronic
1050022589 9:1299879-1299901 AGCGAGTTAGTAGCAAAGCCAGG - Intergenic
1050539592 9:6658641-6658663 TTTCAGTAAGTGGCAGAGCCGGG - Intergenic
1050589089 9:7144350-7144372 GGGGATTAAAAAGCAGAGCCAGG - Intergenic
1051149596 9:14066104-14066126 GGTAAGCAAGTAGCAGCCCCTGG - Intergenic
1051738634 9:20229249-20229271 TGTTATTAAGTAACAGAGCCTGG - Intergenic
1052167011 9:25343515-25343537 AGTGAGAAAATAGCAGAGACTGG + Intergenic
1052866102 9:33465571-33465593 AGTCAGTAAGTGGCAGAGCCAGG + Intronic
1052990480 9:34516545-34516567 TGCTAGTAAGTGGCAGAGCCAGG - Intronic
1053299324 9:36937442-36937464 GTTGAGTAAGTTGCAGAGCCGGG + Intronic
1053492787 9:38523047-38523069 AGTGGGTAAGTAACAGAGCCTGG - Intergenic
1054814243 9:69459686-69459708 AGCTAGTAAGTGGCAGAGCCAGG - Intronic
1055717395 9:79132933-79132955 TGTGAGCAAGGGGCAGAGCCAGG - Intergenic
1055741476 9:79394275-79394297 AGTGAGTAAGTAGCAAAACCAGG - Intergenic
1056510618 9:87301509-87301531 GGTGAGAGAGTAGGACAGCCAGG - Intergenic
1057113875 9:92501768-92501790 TGTGCCTAAGTAGCACAGCCTGG - Intronic
1057189088 9:93076213-93076235 GCTGAGTCGGTAGCAGAGCCAGG - Intronic
1057286038 9:93755167-93755189 GGTGAGTAAGAAGCGGAGCTCGG - Intergenic
1057673016 9:97111967-97111989 AGTGGGTAAGTAACAGAGCCTGG - Intergenic
1057874913 9:98746618-98746640 GGCCAGTAAGTGGCAGGGCCTGG + Intronic
1057951610 9:99373518-99373540 GATTAGAAAGCAGCAGAGCCTGG + Intergenic
1058542460 9:106026077-106026099 GGGGAGTAGGTACCAGAGGCAGG - Intergenic
1058929598 9:109705750-109705772 AGTTAGTAAGTGGCAGAGGCTGG - Intronic
1059308944 9:113375463-113375485 AGTGAGTCAGTGGCACAGCCAGG + Exonic
1059419054 9:114179773-114179795 AGAGAGTAAATGGCAGAGCCAGG + Intronic
1059616094 9:115952492-115952514 AGTTAGTGAGTAGCAGAGCCAGG - Intergenic
1059640501 9:116212043-116212065 GGTGGATAAGTGGCAGAGCTAGG - Intronic
1059708368 9:116844482-116844504 GGTTAGTAAGTGGCAAAGACAGG - Intronic
1059849257 9:118318914-118318936 AGTGATTTAGTGGCAGAGCCGGG + Intergenic
1060064449 9:120491068-120491090 GACGACTAAATAGCAGAGCCTGG - Intronic
1060151948 9:121294473-121294495 GGTCAGGAAGTAGCAGGGCCAGG + Intronic
1060260268 9:122068629-122068651 AGCTAGTAAGAAGCAGAGCCTGG + Intronic
1060381323 9:123175968-123175990 ACACAGTAAGTAGCAGAGCCAGG - Intronic
1060524682 9:124313816-124313838 GGTGAGGAGGTGGGAGAGCCGGG + Intronic
1061158851 9:128881978-128882000 GGGGCGGAAGTAGCGGAGCCGGG - Exonic
1061407805 9:130402410-130402432 GGTGAGTTTTTAGCAGAGCAAGG + Intronic
1061652536 9:132062506-132062528 GGTGACTAAGTACCAGAGCTGGG + Intronic
1061681425 9:132244284-132244306 GGGGTGGAAGTTGCAGAGCCTGG + Exonic
1061812613 9:133171178-133171200 GGCCAGTAAGTAGCAGTGCTGGG - Intergenic
1203687211 Un_GL000214v1:6431-6453 GGTGAGTAAGAAGGGGAGCTCGG + Intergenic
1203755421 Un_GL000218v1:121327-121349 GGTGAGTAAGAAGGGGAGCTCGG - Intergenic
1203714797 Un_KI270742v1:133867-133889 GGTGAGTAAGAAGGGGAGCTCGG - Intergenic
1203649064 Un_KI270751v1:97622-97644 GGTGAGTAAGAAGGGGAGCTCGG - Intergenic
1187420071 X:19126293-19126315 AGCTAGTAAGTGGCAGAGCCAGG + Intergenic
1187546654 X:20260863-20260885 AGTTATTAAGTGGCAGAGCCAGG + Intronic
1187948305 X:24447831-24447853 GGGGAGTAGGGAGCAGAACCAGG + Intergenic
1188083951 X:25880831-25880853 AGTAAGTAAGTTGCAGAGCTAGG - Intergenic
1188442792 X:30229791-30229813 GGTGAGTAAGTGACAGGGCTGGG + Intergenic
1188515694 X:30983150-30983172 AGCTAGTGAGTAGCAGAGCCAGG + Intergenic
1189089991 X:38071715-38071737 AGCTGGTAAGTAGCAGAGCCAGG - Intronic
1189232467 X:39463288-39463310 TATGAGTAAGTTTCAGAGCCTGG - Intergenic
1189300986 X:39952149-39952171 AGTTAGTAAGCAGCAGAGCCAGG + Intergenic
1189520477 X:41762140-41762162 GGTTACAAAGTAGCAGAGCCAGG + Intronic
1189561251 X:42193496-42193518 AGTAAGTAAGTGGCAAAGCCAGG + Intergenic
1189578293 X:42379141-42379163 GCTGGGTGAGTAGCAGAGTCAGG - Intergenic
1190337717 X:49272355-49272377 GGCCAGTAAGTGGCAGCGCCAGG - Intronic
1190462908 X:50696377-50696399 AGCTAGGAAGTAGCAGAGCCAGG - Intronic
1191580844 X:62759080-62759102 GGTGAGTAAGGAGGGGAGCTTGG - Intergenic
1191719902 X:64220630-64220652 AGTGAGGCAGTGGCAGAGCCAGG - Intergenic
1191833834 X:65443208-65443230 GGTGAGTAAGAAGGGGAGCTCGG - Intronic
1191853510 X:65604139-65604161 GACTAGTAAGTTGCAGAGCCAGG + Intronic
1192615705 X:72619893-72619915 AGCAAGTAAGTAGCAGAGCTGGG + Intronic
1192636541 X:72824988-72825010 GGAAAGAAAGTGGCAGAGCCTGG - Intronic
1192645173 X:72895826-72895848 GGAAAGAAAGTGGCAGAGCCTGG + Intronic
1193179376 X:78435571-78435593 AGCTATTAAGTAGCAGAGCCAGG - Intergenic
1193285106 X:79704017-79704039 GGTAAGCAAGCAGCAGAGCCAGG + Intergenic
1193314031 X:80043269-80043291 GGTGAGTAAGAAGGGGAGCTCGG + Intergenic
1194407373 X:93513514-93513536 AGTTAGTTAGTGGCAGAGCCAGG + Intergenic
1194821608 X:98514212-98514234 GGAGAAGAAGCAGCAGAGCCTGG - Intergenic
1194965118 X:100279513-100279535 TGGCAGTAAATAGCAGAGCCAGG - Intergenic
1194970907 X:100342834-100342856 GGAGAGTCAGTAGCTGAGCGTGG + Intronic
1195380975 X:104270500-104270522 GGTGAGGAATTAGCGGAGGCAGG - Intergenic
1195620189 X:106945209-106945231 GGCTAGTAAGTATCAGAGCTGGG + Intronic
1195741972 X:108073950-108073972 AGTTAGTAACTGGCAGAGCCAGG + Intronic
1195976378 X:110532121-110532143 AGTGAGTCAGTAGCACAGACTGG - Intergenic
1196891658 X:120297188-120297210 AGTTTATAAGTAGCAGAGCCAGG - Intronic
1196932127 X:120692779-120692801 GGTGAACATGTAGCAGAGCTAGG - Intergenic
1196989535 X:121312855-121312877 GGTTAGCAAGTAGCAGAGGCAGG - Intergenic
1197707155 X:129642258-129642280 GGTGAGTAAATGGTAGTGCCAGG + Intergenic
1197712408 X:129680968-129680990 GATGAGAAGGTAGCAGAGCGGGG - Intergenic
1197713033 X:129685905-129685927 AATTAGTAAGTAGCAGAGCCAGG - Intergenic
1197772031 X:130095217-130095239 AGCCAGTAAGTGGCAGAGCCGGG + Intronic
1198226906 X:134653563-134653585 GGTGAGTTAGATGCAGAGCTGGG + Intronic
1198376701 X:136048062-136048084 AGCGAGTAAGTGGCAGAGTCAGG + Intergenic
1198574512 X:137995441-137995463 GGCTACTAAATAGCAGAGCCTGG + Intergenic
1198662602 X:138986386-138986408 AATGAGTGAATAGCAGAGCCAGG + Intronic
1198816258 X:140594264-140594286 GGCCAGTGAGTGGCAGAGCCAGG + Intergenic
1198864551 X:141107606-141107628 GGCTAGTAAGTGTCAGAGCCAGG - Intergenic
1198898140 X:141479801-141479823 GGCTAGTAAGTGTCAGAGCCAGG + Intergenic
1199910600 X:152282705-152282727 GGTGAGGAAGCAGCAGAGTGAGG + Intronic
1200064765 X:153499038-153499060 GGTGAGGAAACAGCAGAGCTGGG - Intronic
1200887209 Y:8281577-8281599 GGTGTCTAAGCAGCAGAGCTGGG + Intergenic
1201169038 Y:11238933-11238955 GGTGAGTAAGAAGGGGAGCTCGG - Intergenic
1201959132 Y:19659694-19659716 GGTGAGTAAGAAGGGGAGCTCGG - Intergenic