ID: 981268083

View in Genome Browser
Species Human (GRCh38)
Location 4:142811172-142811194
Sequence ATATATGCACAGGTGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981268083_981268087 4 Left 981268083 4:142811172-142811194 CCTACCTCCACCTGTGCATATAT 0: 1
1: 0
2: 1
3: 22
4: 200
Right 981268087 4:142811199-142811221 TCAGCACACCAAAGTAGTAGTGG No data
981268083_981268089 13 Left 981268083 4:142811172-142811194 CCTACCTCCACCTGTGCATATAT 0: 1
1: 0
2: 1
3: 22
4: 200
Right 981268089 4:142811208-142811230 CAAAGTAGTAGTGGAGTCATAGG 0: 1
1: 0
2: 2
3: 7
4: 103
981268083_981268090 19 Left 981268083 4:142811172-142811194 CCTACCTCCACCTGTGCATATAT 0: 1
1: 0
2: 1
3: 22
4: 200
Right 981268090 4:142811214-142811236 AGTAGTGGAGTCATAGGCAGTGG 0: 1
1: 0
2: 1
3: 11
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981268083 Original CRISPR ATATATGCACAGGTGGAGGT AGG (reversed) Intronic
900770946 1:4543619-4543641 ATACAGGCACAGGTGCAGGTAGG - Intergenic
901507850 1:9697326-9697348 ATATATGTGGAAGTGGAGGTCGG + Intronic
903677837 1:25075824-25075846 ATATGTGCACATTTGGGGGTGGG - Intergenic
904152455 1:28453508-28453530 ATATATACATAGGTGGTGGCTGG + Intronic
904542225 1:31240587-31240609 AGATCTGCCCAGGTGGAGGTAGG + Intergenic
904684044 1:32248083-32248105 ATATTTGCACATGTTGAGTTGGG - Intronic
904953475 1:34263195-34263217 TCATATTCAGAGGTGGAGGTCGG + Intergenic
905909078 1:41641460-41641482 ATCTCTGAACTGGTGGAGGTGGG - Intronic
907237644 1:53062758-53062780 ATCTATAAAGAGGTGGAGGTTGG - Intronic
907264413 1:53248277-53248299 ATATCTACACTGGTGGAGGATGG - Intronic
910801334 1:91149658-91149680 ATATATGAATAGGAGGGGGTTGG - Intergenic
912838684 1:113019777-113019799 ACAGATGCAGAGGTGGAGTTTGG - Intergenic
914910750 1:151784142-151784164 ATTTAGGCACAGGTGGAGGAAGG - Intronic
914975788 1:152360083-152360105 AAATATGTAGAGGTGGAGTTAGG - Intergenic
915284259 1:154842717-154842739 ATATATGCAAGGGGAGAGGTTGG - Intronic
917887683 1:179402449-179402471 ATATAAGCACAGATGCAGGTGGG - Intronic
917994030 1:180415752-180415774 ATACATGCACATTTGGAAGTTGG - Intronic
918026563 1:180754926-180754948 ATATCTGCATGGGTGGGGGTGGG + Intronic
919302320 1:195786463-195786485 ATAAATGCACATGTGAAGTTGGG - Intergenic
921151863 1:212409139-212409161 ATTTTTCCACAGATGGAGGTTGG - Intronic
923427031 1:233881269-233881291 CTAAATGCAGAGATGGAGGTGGG - Intergenic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1065306521 10:24374240-24374262 AGATATGCACCGTTGGAAGTTGG + Intronic
1065457046 10:25917560-25917582 ATATATGCACAGATGTGGGCAGG - Intergenic
1067107944 10:43377982-43378004 ATACATGTGAAGGTGGAGGTGGG - Intergenic
1067276319 10:44838301-44838323 ATATAAGAAAATGTGGAGGTGGG + Intergenic
1067939030 10:50636866-50636888 ATAGATGCTGGGGTGGAGGTGGG + Intergenic
1068674293 10:59754143-59754165 ATATAGGTACATGTGGGGGTTGG + Intergenic
1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG + Intergenic
1077479921 11:2808973-2808995 ATAGATGCAGAGATGGAGGGAGG + Intronic
1079733333 11:23962850-23962872 ACATATGCAGATGTGGAGCTGGG - Intergenic
1080256472 11:30295828-30295850 ATGTTTGCACTGGTGGTGGTTGG - Intergenic
1080282991 11:30580244-30580266 ACATATGTACATGTGGAGGCTGG + Exonic
1083169023 11:60911306-60911328 ATATATGCATTGGTGCTGGTGGG + Intergenic
1083489962 11:63008988-63009010 TTATGTGCGCAGGAGGAGGTGGG - Intronic
1085946067 11:81275128-81275150 AAATATGCACTTGTGGAAGTTGG - Intergenic
1086734389 11:90287428-90287450 TTATATCCACAGGTAGAGGGAGG + Intergenic
1088783965 11:113164040-113164062 ATATCTGCACAAGGGGAGGGAGG - Intronic
1092150296 12:6243451-6243473 CTACATTCACAGGTAGAGGTAGG + Intergenic
1093079742 12:14795786-14795808 ATATATCCAGTGGTGGAGGTTGG + Intronic
1097321824 12:58234070-58234092 GTATATCAACAGGTGGAGGTGGG - Intergenic
1097812656 12:64035334-64035356 ATATATGCAGAGGTGGGAGAGGG - Intronic
1100449092 12:94688339-94688361 ATATGGGCACAGGAGCAGGTGGG - Intergenic
1101634659 12:106528593-106528615 AGAAATGCAAAGATGGAGGTGGG + Intronic
1103525776 12:121567175-121567197 ATATATTCCCAGGTGGGGGGCGG - Intronic
1103924757 12:124417406-124417428 ACATTTGCACAGAGGGAGGTGGG - Intronic
1105416660 13:20219131-20219153 ATTGATGGGCAGGTGGAGGTGGG + Intergenic
1106671900 13:31915035-31915057 CGATAGGCAGAGGTGGAGGTGGG + Intergenic
1107884064 13:44859560-44859582 ATATATGCACAGGTGATTGGAGG + Intergenic
1108618755 13:52160473-52160495 ATATATATAAAGGAGGAGGTGGG + Intergenic
1110581219 13:77130431-77130453 ATATATGTACAGATGAATGTGGG + Intronic
1111441611 13:88288350-88288372 ATATATGCACAGTTCCTGGTAGG - Intergenic
1112547196 13:100382384-100382406 TTATAGGCACAGGATGAGGTGGG + Intronic
1113072908 13:106438819-106438841 ATATATGGATGGGTGGAGGGAGG + Intergenic
1114216826 14:20663516-20663538 AGAGATGCACAGGTGGAGGAAGG - Intergenic
1120806277 14:88754387-88754409 ATTTGTCCAAAGGTGGAGGTGGG - Intronic
1124507537 15:30291399-30291421 GTCTAAGCACAGGTGGTGGTGGG + Intergenic
1124650867 15:31472961-31472983 ATATATGCATGTGTGTAGGTGGG + Intergenic
1124736018 15:32247259-32247281 GTCTAAGCACAGGTGGTGGTGGG - Intergenic
1124820921 15:33044861-33044883 GTATATGGACAAGTGGAGGGGGG - Intronic
1124991055 15:34674197-34674219 AAATATGCACAGGTGGCTGTGGG - Intergenic
1126884499 15:53135192-53135214 AGATATGCTCAGGTGGTGGTCGG + Intergenic
1127531653 15:59849253-59849275 AAAAAAGCACAGGTGGAGGCGGG + Intergenic
1127772542 15:62243227-62243249 ATCTCTGCAGGGGTGGAGGTGGG - Intergenic
1128458521 15:67847941-67847963 CTGTATCCACATGTGGAGGTAGG + Intergenic
1129175915 15:73839614-73839636 AAGGCTGCACAGGTGGAGGTGGG + Intergenic
1132162865 15:99558967-99558989 ATATATGCAAGGGTCGAAGTGGG + Intergenic
1133563008 16:6967044-6967066 ATATATGGATAGATGGAGGGTGG - Intronic
1136547996 16:30966075-30966097 CTATATGCACAGGGGCAGGAGGG + Exonic
1137563823 16:49521111-49521133 ATAAGTGCAGAGGTGGAGGGAGG - Intronic
1137572063 16:49573092-49573114 ATATATGAACATGTGGACGATGG + Intronic
1138024428 16:53511647-53511669 GGATATGGACAGGTGGTGGTTGG - Intergenic
1138585297 16:57965620-57965642 ATATATACACATGTGGAGACAGG + Intronic
1139412833 16:66779153-66779175 TTATATGCACAGGTAAAGATTGG - Intronic
1141658507 16:85429143-85429165 ATACATGCAGAGGTGCAGGTGGG + Intergenic
1143812585 17:9484424-9484446 ATGTATGCTGAGGTGGGGGTTGG + Intronic
1144835817 17:18156184-18156206 ATATCTGCAAAGCTGGAGGATGG - Exonic
1146939280 17:36832982-36833004 ATATATGCACAGATAGCTGTGGG - Intergenic
1148155191 17:45420102-45420124 ATATATGTACAGGTAGAAGTAGG - Intronic
1148338722 17:46860315-46860337 TTATGTGCTCAGGTGGAAGTTGG + Intronic
1149450783 17:56748379-56748401 ACATGTGCACAGCTGTAGGTGGG - Intergenic
1150386925 17:64769048-64769070 ATATATGTATAGGTAGATGTTGG - Intergenic
1150657007 17:67045817-67045839 ACAAAAGGACAGGTGGAGGTCGG - Intronic
1151175022 17:72281030-72281052 GTGCATGCATAGGTGGAGGTGGG - Intergenic
1151582304 17:74987537-74987559 ATGTATGCAAAGCTGGAGGCGGG - Intergenic
1153825835 18:8874041-8874063 AAATAATCAGAGGTGGAGGTGGG - Intergenic
1155377177 18:25172883-25172905 TTATATGTACAGGTGGATATTGG - Intronic
1157283928 18:46364298-46364320 AAAAGTGCATAGGTGGAGGTGGG - Intronic
1157484530 18:48077642-48077664 ACAGATGCACACGTGGAAGTCGG + Intronic
1159590774 18:70332740-70332762 TTGTATCCACAGGTGGTGGTTGG - Intergenic
1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG + Intergenic
1162775494 19:12976385-12976407 GTAAATGCACAGGGGTAGGTTGG + Intergenic
1164686700 19:30171639-30171661 ATATGTGCATAGGTGTATGTAGG + Intergenic
1165432064 19:35778516-35778538 AAATATGCACCGGTGGAGGTGGG - Exonic
925311983 2:2891132-2891154 ATGTAAGCACATCTGGAGGTAGG + Intergenic
925556654 2:5138176-5138198 ATGTAAGCACAGGTGGTGCTTGG - Intergenic
926482487 2:13417178-13417200 ATATATGCATATGTGGAGTATGG - Intergenic
926556708 2:14365981-14366003 ATATATACTGAGGTGGGGGTGGG - Intergenic
926632433 2:15148542-15148564 GAATATGCTCAGGTGAAGGTTGG + Intergenic
926814509 2:16787014-16787036 ATCGATGCCCAGGAGGAGGTGGG - Intergenic
927033403 2:19146943-19146965 AGATATGAAAAGGTGGGGGTAGG - Intergenic
929458161 2:42081002-42081024 ATATATGGAGAGGCTGAGGTGGG + Intergenic
929834916 2:45386655-45386677 ATATGAGCACAGATGTAGGTAGG - Intergenic
931961118 2:67484474-67484496 ATATATGCAGAGGTGCATATAGG - Intergenic
932724642 2:74168849-74168871 AAATATGCCCAGGTGGAAGTTGG + Intronic
932899361 2:75680879-75680901 ATATCGGCACAGATGTAGGTAGG - Intronic
933350794 2:81149988-81150010 ATTTATGTACACGTGGAGGGTGG + Intergenic
933582342 2:84141961-84141983 ATATTGGCTCAGGTTGAGGTTGG - Intergenic
933635124 2:84700338-84700360 ATATGAGCACAGATGCAGGTAGG + Intronic
939422417 2:141990593-141990615 GTCTATGCACAGGTAGAGCTAGG + Intronic
939994694 2:148908966-148908988 ATATATGCTCAGGTGAAATTTGG - Intronic
940391658 2:153139576-153139598 AGATATGAACAGATGGAGATGGG + Intergenic
940477248 2:154178492-154178514 ATATATACACATGTGCATGTTGG - Intronic
943745173 2:191454694-191454716 ATTTTTTCACAGTTGGAGGTGGG + Intergenic
945676557 2:212861885-212861907 GTATATGCACAGGTGTATATGGG - Intergenic
945978214 2:216287076-216287098 TTACAGGCACAGGTGCAGGTGGG - Intronic
948337407 2:237221346-237221368 ATATAAGTACAGGTGAAGATAGG - Intergenic
948949606 2:241240422-241240444 TGATCTGCACAGGGGGAGGTGGG + Intronic
948968205 2:241401356-241401378 AACTAAGCAGAGGTGGAGGTGGG - Intronic
1170521612 20:17191531-17191553 ATATATGCACATGTACATGTAGG - Intergenic
1171883906 20:30637708-30637730 AAAGATGCACAGGTAGAGCTTGG - Intergenic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
1176191884 20:63815314-63815336 AGATGGGCACAGGTGCAGGTGGG + Intronic
1178479945 21:32971168-32971190 ATATATGCGGGGGTGGGGGTGGG - Intergenic
1180046806 21:45310347-45310369 GCATGTCCACAGGTGGAGGTGGG + Intergenic
1181500194 22:23311604-23311626 ATATCTGCACACCCGGAGGTGGG - Intronic
1181538459 22:23560227-23560249 ATAAATGCCCAGGAGTAGGTTGG - Intergenic
1182703010 22:32255608-32255630 AGATTTGCCCAGGTGGAGGGGGG + Intergenic
1183178183 22:36239500-36239522 ACAGATGCACAGCTGGACGTGGG - Exonic
1183289737 22:36992959-36992981 ATGTAAGCTGAGGTGGAGGTCGG + Intronic
1184961231 22:47930289-47930311 GTACATGCAAAGCTGGAGGTGGG + Intergenic
1185389594 22:50551864-50551886 AGAGGTGCCCAGGTGGAGGTGGG - Intronic
949507281 3:4739645-4739667 AGATAACTACAGGTGGAGGTGGG - Intronic
949967298 3:9368341-9368363 AAATATGCGCGGGTGGAGGTGGG - Intronic
954091483 3:48287804-48287826 ACATAAGCACAGATGGAGATAGG + Intronic
954743739 3:52774886-52774908 ATGTTTGCACAGGGGGAGGGTGG - Intergenic
955215411 3:56981411-56981433 ATAAAGGCAGAGGTGTAGGTAGG + Intronic
955600638 3:60641841-60641863 CTATTTTCAGAGGTGGAGGTTGG + Intronic
957724208 3:84044035-84044057 ATTTATCCATAGATGGAGGTTGG + Intergenic
960814728 3:121660815-121660837 AGGCTTGCACAGGTGGAGGTGGG - Exonic
961000621 3:123371782-123371804 AGATATGCAGGGGTGGGGGTGGG - Intronic
964142513 3:153419951-153419973 ATACATGCACATGTGGAGCCCGG - Intergenic
965595825 3:170409980-170410002 ATATCTGTACAGTTGGAGATTGG - Intergenic
965687697 3:171322632-171322654 ATATACGCACATATGCAGGTAGG + Intronic
968758970 4:2432191-2432213 ATAGATGCAATGCTGGAGGTAGG - Intronic
969109377 4:4832685-4832707 GTATATGTACAGGTGGTGGTTGG - Intergenic
971214593 4:24651401-24651423 TTGTATGCATTGGTGGAGGTGGG + Intergenic
971642250 4:29149186-29149208 ATAAAGTCACAGGTGGAAGTAGG - Intergenic
972132043 4:35849848-35849870 ATATATGTACAAGTGGAAATGGG + Intergenic
974436864 4:61867789-61867811 AAATATGCACAGTTTGAGGATGG - Intronic
974684742 4:65212635-65212657 AGAGATGCACAGGGTGAGGTAGG - Intergenic
974764735 4:66329039-66329061 ATAAATGTTCAGGGGGAGGTAGG - Intergenic
975373368 4:73613597-73613619 ATGGATGGAGAGGTGGAGGTAGG - Intronic
976599739 4:86927219-86927241 ATATATCAAAAGGTGGAGGCCGG + Intronic
977070591 4:92380480-92380502 AAATATGTAGAGGTGGAGTTGGG - Intronic
977432744 4:96952792-96952814 TTCTGTACACAGGTGGAGGTGGG + Intergenic
981002440 4:139840659-139840681 CCTTATGAACAGGTGGAGGTGGG + Intronic
981268083 4:142811172-142811194 ATATATGCACAGGTGGAGGTAGG - Intronic
982750036 4:159149941-159149963 AAACAGGCACAGGTGGAGGTTGG + Intronic
983029972 4:162787618-162787640 ATATATGCACTGGAGGAAATGGG - Intergenic
983657803 4:170100529-170100551 ATATATGCACATGTAGAAGTAGG - Intergenic
984638833 4:182142567-182142589 GTACAGGTACAGGTGGAGGTCGG + Intergenic
986865590 5:11982555-11982577 ATATATTTAGGGGTGGAGGTGGG + Intergenic
987246634 5:16055492-16055514 ATATATATATAGTTGGAGGTGGG - Intergenic
991262906 5:64686025-64686047 TAATATGCACAGGTGGCAGTGGG - Intergenic
992204581 5:74418818-74418840 GTATTTTTACAGGTGGAGGTGGG - Intergenic
992501890 5:77351362-77351384 ATAGGTGATCAGGTGGAGGTGGG - Intronic
992849461 5:80791819-80791841 ATAAATGCACAGAAGAAGGTTGG + Intronic
993509284 5:88751610-88751632 ATATAGCCACAGGAGGAGATAGG + Intronic
993574120 5:89580413-89580435 ATTTTTGTAGAGGTGGAGGTGGG + Intergenic
993750928 5:91666522-91666544 AAATATGGACAGGTAGAGGAAGG + Intergenic
996848931 5:127931492-127931514 CAATATGCACAGCTGGAGGAGGG - Intergenic
997058350 5:130471209-130471231 CTATATGCATGTGTGGAGGTAGG - Intergenic
1000606294 5:163331119-163331141 ATTTTTGCACAGGTGGTGTTAGG + Intergenic
1001425768 5:171621322-171621344 ATATATGAACAGATGGAAGGTGG + Intergenic
1002388083 5:178885776-178885798 ACATATGCAAAGGTGTAGGGTGG + Intronic
1002553017 5:180011474-180011496 ATATATACAAAGGTTGAGGGTGG + Intronic
1003353231 6:5340640-5340662 ATAAATGCAAAGATGGAAGTAGG + Intronic
1005071462 6:21866174-21866196 AGATAGGCACAGGGGCAGGTTGG - Intergenic
1006483613 6:34319470-34319492 AGAGATGCACAGGGCGAGGTTGG + Intronic
1008452195 6:51665923-51665945 GTGTAAGCACAGGTGGAGGTGGG + Intronic
1011801932 6:91027002-91027024 TTGTATGCACGCGTGGAGGTAGG + Intergenic
1016735256 6:147471224-147471246 ACATATGCACATTTGGTGGTGGG + Intergenic
1016782299 6:147972833-147972855 ATATATGCAGATGTTGAGGTGGG - Intergenic
1019859356 7:3643368-3643390 ACAGATGCTCAGGTGGGGGTGGG - Intronic
1019859368 7:3643425-3643447 ACAGATGCTCAGGTGGGGGTAGG - Intronic
1019859405 7:3643595-3643617 ACAGATGCTCAGGTGGGGGTGGG - Intronic
1019859444 7:3643766-3643788 ACAGATGCTCAGGTGGGGGTGGG - Intronic
1021119443 7:16781804-16781826 ATATTTGGGCAGGTTGAGGTGGG + Intronic
1024221145 7:47288177-47288199 ATATGGGCACAGCTGGACGTGGG + Intronic
1026609946 7:71849292-71849314 ATATATGCCCAGGTCTACGTGGG - Intronic
1032519958 7:132536406-132536428 GTGCATGCAGAGGTGGAGGTAGG - Intronic
1034051629 7:147990183-147990205 AGAGATGCACAGGGTGAGGTCGG + Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1035004813 7:155648207-155648229 AAATATACAAAAGTGGAGGTGGG - Intronic
1037706030 8:21315950-21315972 ATCTATGCACAGATTGAGGTTGG - Intergenic
1037760950 8:21741214-21741236 AGAGATGCACAGGTTGAGGTTGG - Intronic
1039071625 8:33654150-33654172 ACATATGAACTGGTGGGGGTGGG - Intergenic
1039433949 8:37546989-37547011 AAACAGGCACAGGTAGAGGTGGG - Intergenic
1041780167 8:61569103-61569125 ATACAGGCACAGGTAGAGGATGG + Intronic
1042317897 8:67443815-67443837 AGATATTGACAGCTGGAGGTAGG + Intronic
1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG + Intronic
1046130564 8:109962815-109962837 TAATAGGCACAGATGGAGGTAGG + Intergenic
1046480895 8:114816562-114816584 ACAAATGCAATGGTGGAGGTTGG - Intergenic
1047991196 8:130288466-130288488 GTAAATGCACAGCTGCAGGTAGG - Intronic
1048601391 8:135922382-135922404 ATAAATGGATAGGTGGAGATTGG - Intergenic
1052297767 9:26917155-26917177 TTGCATGCACAGGTGGTGGTCGG - Exonic
1052995625 9:34550410-34550432 ATCTGTGCACAGGTGGGTGTGGG + Intergenic
1055104007 9:72493583-72493605 AGAGATGGACAGGTGGGGGTTGG + Intergenic
1055772409 9:79731380-79731402 ACAGCTGCACAGGTGGTGGTGGG - Intergenic
1059359297 9:113727877-113727899 ATATATGAACTGGTGGGGGTGGG + Intergenic
1060052592 9:120387923-120387945 ATATTTGCACAGGTGTACCTCGG - Intergenic
1060316343 9:122514916-122514938 ATATCTCCGCAGGTGGAGCTGGG + Intergenic
1062083270 9:134635748-134635770 ATATACACGCAGCTGGAGGTTGG - Intergenic
1188917033 X:35924583-35924605 ATATATACACACGTGCATGTGGG + Intronic
1190150717 X:47945128-47945150 ATACCTGCACTGGTGGAGTTGGG - Intronic
1190449508 X:50564248-50564270 ATATATGTCCAGGAGGTGGTTGG + Intergenic
1194427426 X:93756812-93756834 ATTTAGGTTCAGGTGGAGGTGGG + Intergenic
1194802502 X:98290330-98290352 AAATGAGCACAGGTGGAGTTTGG - Intergenic
1195791454 X:108592205-108592227 ATATGGGCACAGGTGCAAGTAGG - Intronic
1195920747 X:109981165-109981187 TTATAGGCACAGGTGCAGGCAGG + Intergenic
1197181292 X:123539523-123539545 AAAGATGCACTGGTGAAGGTAGG - Intergenic
1199830375 X:151543883-151543905 ACATATGCACTGGGGGAAGTGGG - Intergenic
1200629889 Y:5570182-5570204 TTATATGCACAGGAAGAGGAGGG - Intronic