ID: 981268670

View in Genome Browser
Species Human (GRCh38)
Location 4:142818373-142818395
Sequence GCCTCTGAGAGAAAAACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981268670_981268675 13 Left 981268670 4:142818373-142818395 CCATGGGTTTTTCTCTCAGAGGC 0: 1
1: 0
2: 1
3: 23
4: 218
Right 981268675 4:142818409-142818431 GTTTTTTCTACAAAAAAGGAAGG 0: 1
1: 1
2: 4
3: 54
4: 517
981268670_981268674 9 Left 981268670 4:142818373-142818395 CCATGGGTTTTTCTCTCAGAGGC 0: 1
1: 0
2: 1
3: 23
4: 218
Right 981268674 4:142818405-142818427 GCTTGTTTTTTCTACAAAAAAGG 0: 1
1: 1
2: 3
3: 56
4: 570

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981268670 Original CRISPR GCCTCTGAGAGAAAAACCCA TGG (reversed) Intronic
900333565 1:2149430-2149452 GCCTCTGCTCGTAAAACCCAGGG + Intronic
900545420 1:3226260-3226282 GCATCTGAGAGGAACACCGAGGG + Intronic
901472297 1:9466068-9466090 GCCTTTTAGAGATAAACCCTGGG + Intergenic
902272972 1:15317907-15317929 GACTCTGAGAGAAAAAAGCAAGG + Exonic
903327862 1:22581581-22581603 GGCTCTGAGTGGAAACCCCAGGG + Intronic
903328022 1:22582385-22582407 ACCTCTAAGGGCAAAACCCAAGG - Intronic
903941972 1:26938186-26938208 GCCTCAGACAGATAACCCCAGGG - Intronic
906948148 1:50313264-50313286 GCCTCTGAGGGGAAAACCTGAGG - Intergenic
907574058 1:55509979-55510001 GGCTTTGAGAGAGAAAACCAAGG - Intergenic
908651683 1:66339910-66339932 GTCTATGAAAGAAAAACCAAGGG + Intronic
910859677 1:91731450-91731472 CCCTCAGAGAGAAAAGCTCAAGG + Intronic
912244235 1:107944101-107944123 CCTACTGAGTGAAAAACCCAAGG + Intronic
913067161 1:115266702-115266724 ACATCTGAGGGAAAAATCCATGG - Intergenic
913214796 1:116611163-116611185 GTTTCAGAAAGAAAAACCCATGG - Intronic
916028227 1:160853965-160853987 GCCATTGAAAGAAAAAGCCAAGG + Intronic
918047413 1:180949721-180949743 GCATCTGAGCAAAAAACCCCAGG - Exonic
920168208 1:204051362-204051384 GCCTCTAAAAAAAAAAACCAGGG - Intergenic
920170173 1:204067138-204067160 GCCTCTGAGAAGAAGCCCCACGG + Intergenic
922187848 1:223292330-223292352 GCATCAGAGAGAAGAGCCCAGGG + Intronic
922559413 1:226558348-226558370 GCCACTCAGAGAAATACCCCAGG - Intronic
922902339 1:229146854-229146876 GCCTCTGAGAGGAGGACTCAGGG - Intergenic
924271632 1:242339724-242339746 TCCTCTGAGATAAAAATCGAAGG + Intronic
1064359758 10:14653508-14653530 AGCTCTGGGAGAAAAGCCCATGG + Intronic
1065553798 10:26894233-26894255 CCCTCTTCGAGAAACACCCACGG + Intergenic
1066713035 10:38256404-38256426 TCCTCTGAGACAAAAATCGAAGG - Intergenic
1067538225 10:47132748-47132770 GCCTATGAGAGAACATGCCAGGG - Intergenic
1069990178 10:72310392-72310414 GCCTCGGAGAGGAAAACCACGGG - Intergenic
1070688163 10:78505101-78505123 GGCTCTGAGAGAAAGACCAGTGG + Intergenic
1071443624 10:85726307-85726329 GTCTCTGAGAGACATAGCCAAGG + Intronic
1072721865 10:97786190-97786212 GCACCTGAGAGAGAACCCCATGG + Intergenic
1074265460 10:111898347-111898369 CCCTCTGATTGATAAACCCAAGG + Intergenic
1076027363 10:127126862-127126884 GGCTCTGAGAGAATGAGCCAGGG - Intronic
1076786901 10:132754415-132754437 GTGCCTGAGAGAAAACCCCAGGG - Intronic
1079350957 11:19691694-19691716 GCCACAGTGGGAAAAACCCAAGG - Intronic
1080450837 11:32377602-32377624 GCCTCTGAGAGAAGAAACCAAGG + Intergenic
1084450253 11:69232609-69232631 GGCTCTGAGAGAATCACCCCAGG - Intergenic
1088001814 11:104891197-104891219 GAGTCTGAAAGACAAACCCAAGG - Intergenic
1088077265 11:105865889-105865911 TCCACTGTGATAAAAACCCAAGG + Intronic
1088680115 11:112233145-112233167 GCCTCCTAGAGACAAAACCAAGG - Exonic
1088796291 11:113269189-113269211 GCCCCTGGGAGATCAACCCATGG - Intronic
1089048865 11:115528460-115528482 GCCTCTGGGAATAAAACCCAGGG + Intergenic
1089126605 11:116180869-116180891 CTCTCAGAGAGAAAAATCCATGG + Intergenic
1091251521 11:134147997-134148019 CCCTCTGAGAGGAAACCCCCTGG - Intronic
1095262371 12:40111177-40111199 TCCTCTGAGAAAAAAAGGCAAGG + Intergenic
1095280852 12:40351189-40351211 GCCAGTGAGAGAAAAACCCTTGG - Intronic
1096778577 12:53978802-53978824 ACCTCTGAGAGAAAACTCCCTGG + Intergenic
1097401304 12:59131280-59131302 GCATCTGAGAGAGAGGCCCACGG + Intergenic
1098160316 12:67643288-67643310 GCCTCTAGGAGATAAGCCCATGG - Intergenic
1102027683 12:109722880-109722902 GCTTCTGAGAGAACAAGACAAGG + Intronic
1103321795 12:120096524-120096546 GCCTCTGAGCTCCAAACCCAGGG - Exonic
1104066419 12:125310635-125310657 GCCACTGAGAGACAGCCCCACGG - Intronic
1106743385 13:32672556-32672578 GCCTCTGAGAGTAACACCATTGG - Intronic
1110491704 13:76117679-76117701 GACTATGAGAGAAAGACCCCGGG + Intergenic
1112462669 13:99616554-99616576 GCCACTTACAGAAACACCCATGG - Intronic
1113069351 13:106405041-106405063 TCCTCTGGGAGAAGAACCCAGGG + Intergenic
1113801881 13:113090961-113090983 GCTTCTGTGAGCAAAACACAGGG - Intronic
1114759486 14:25297275-25297297 GCGTTTAATAGAAAAACCCAGGG - Intergenic
1117702663 14:58429400-58429422 GCCTCTATTAGAAAATCCCATGG + Exonic
1118382145 14:65226158-65226180 GCCTCTCAGAGAGAAGCTCAAGG - Intergenic
1118774225 14:68963296-68963318 GCCTGTGAGTGAGAGACCCAGGG - Intronic
1120719383 14:87873892-87873914 GCTTTTGAAAGAAACACCCAGGG - Intronic
1120852733 14:89186077-89186099 GCCTCTGAGAGAGTTAGCCAGGG - Intronic
1121266974 14:92610537-92610559 GCCTCTCACAGTAAAACACATGG + Intronic
1122203742 14:100137986-100138008 CCCTCTGAGAGAGAGACCAAGGG + Intronic
1123787902 15:23690792-23690814 CAGTCTGAGGGAAAAACCCATGG + Intergenic
1125464655 15:39938821-39938843 GAGTCTGAGAGAAAAAACAATGG - Intronic
1127146704 15:56032496-56032518 GCCTGAGAGGGAAAAAACCAGGG - Intergenic
1127370335 15:58332938-58332960 CCCTCTGAGAGAAGAACAAAGGG - Intronic
1127622403 15:60746594-60746616 ACCTTTGAAAGACAAACCCAAGG + Intronic
1127639501 15:60902686-60902708 CTCTCTGAGAGGAAAACCCTTGG + Intronic
1128767894 15:70262201-70262223 GGTTGTGAGAGAAAAACCGAGGG - Intergenic
1129247465 15:74288218-74288240 GCCTCTGGGAGGAAAAGGCAGGG - Intronic
1129535393 15:76310320-76310342 GCCTCAGAGAGAAAAATCCCAGG + Intronic
1131352278 15:91712297-91712319 AGATCTGAGACAAAAACCCAGGG + Intergenic
1135226953 16:20669052-20669074 GCCTCTGAGAGGGAAAGCAAGGG + Intronic
1136533019 16:30882557-30882579 GCCAGTGTGAGCAAAACCCAAGG + Intronic
1137366644 16:47865222-47865244 CCCTCTTTGAGAAACACCCACGG + Intergenic
1139479774 16:67223924-67223946 GCATCTGAGGGAAAAAGACAGGG + Intronic
1139656133 16:68388221-68388243 GGCTCTGAGGGCAAAAGCCAGGG - Intronic
1140208678 16:72953967-72953989 GCCTCAGAGAAACAAGCCCAGGG + Intronic
1141161251 16:81630550-81630572 GCTTCTGTGAGAAAACCCCACGG - Intronic
1142345828 16:89553497-89553519 GCCTATGCGAGGCAAACCCATGG - Intronic
1143530070 17:7497629-7497651 GCCTGTGAGGAAAAAACACAGGG - Exonic
1143946059 17:10593495-10593517 GCCACTGAGAGGAAAGGCCAGGG - Intergenic
1144132918 17:12265566-12265588 GGCTCTGAGACAGAAACACAGGG - Intergenic
1145816319 17:27797545-27797567 GCCTCTGACAGATACACTCAGGG + Intronic
1148055827 17:44794890-44794912 GCTTCTGAAAGAAAAACCTAAGG - Intergenic
1148538834 17:48463519-48463541 GCCTTTGAAAGAAAAATCCAGGG + Intergenic
1148758543 17:49987368-49987390 GCCTCCCAGGGAAGAACCCAGGG + Intergenic
1149514621 17:57271027-57271049 GCCTCTGAGAGTAAAGTCCCGGG + Intronic
1150239171 17:63618434-63618456 GCCACTGAGAAAAAAAAACAAGG + Intergenic
1151618255 17:75228886-75228908 GGCACTGAGAGACAAACCCCTGG - Intronic
1152291136 17:79440844-79440866 GCCTCTGAGGGACAAACCCTGGG - Intronic
1152737673 17:82005295-82005317 GCCTCCGAGACCAAACCCCAGGG - Intronic
1153510239 18:5843992-5844014 GACTGTAAGAGAAAAAGCCATGG - Intergenic
1154192773 18:12244125-12244147 CCCTCTCCGAGAAACACCCAAGG + Intergenic
1155579993 18:27293180-27293202 GCTGCTGAGAGAAAACACCATGG + Intergenic
1156319648 18:36007073-36007095 TCCTTTGAGAGTAAAACACAGGG - Intronic
1157013556 18:43681901-43681923 GCAACTGAGAGAAAATTCCAAGG + Intergenic
1157243119 18:46029774-46029796 ACCTCTGAGAGAAAATTCCATGG - Intronic
1157534410 18:48447966-48447988 GCCACTGAGAGTAAAATCCAAGG + Intergenic
1157792254 18:50543047-50543069 TCCTCTGAGAGGAGAAGCCAGGG - Intergenic
1158127277 18:54115059-54115081 GCCCCAGAGAGAAAATGCCAAGG + Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1161729384 19:5949825-5949847 GCCTCTGTGAGAAGTACGCAGGG + Intronic
1161914505 19:7218437-7218459 GAATCTCTGAGAAAAACCCATGG - Intronic
1163417235 19:17194214-17194236 GCCTCCTAGAAAAAGACCCAAGG + Intronic
1164475777 19:28575003-28575025 GACTCTGAGACAAGAACTCATGG + Intergenic
1168065730 19:53919290-53919312 GCCTCAGAGAGAGAAAGACAGGG + Intronic
1168517739 19:57022548-57022570 CCCTCCAAGAGACAAACCCAGGG - Intergenic
1168598711 19:57700752-57700774 GCCTCTGAGAAAAAACTACAGGG - Exonic
925289215 2:2735721-2735743 GACTCAGAGAGCAGAACCCAGGG + Intergenic
926148970 2:10414053-10414075 ACCTCTGAGAGGCAAAGCCAGGG - Intronic
927259770 2:21076138-21076160 GCCTGAGAGTGAGAAACCCATGG - Intergenic
928020850 2:27703618-27703640 TTCTCTGACAGAAAAACCCAAGG - Intergenic
929439428 2:41953624-41953646 TTCTCTCGGAGAAAAACCCAAGG + Intronic
931315056 2:61121255-61121277 GCAGCTCAGAGAAAAACACAAGG + Exonic
932171283 2:69558801-69558823 GCCTCTGAGAAATAAAGCCTCGG + Intronic
932757076 2:74416238-74416260 GCCTCTGTGAGAACAAAACATGG + Exonic
933086492 2:78059987-78060009 GCCTCTGTGAGATATACTCAGGG + Intergenic
933370935 2:81414700-81414722 ACCCCTGAGGGAAAAACCAAAGG + Intergenic
934261353 2:91478660-91478682 GCCGCGGCGAGAAAAAGCCATGG - Intergenic
935854261 2:107257771-107257793 GCCACAGAGAGAAACAGCCAGGG + Intergenic
935878095 2:107534268-107534290 GCATCTGAGAACAAAAACCAGGG - Intergenic
936684373 2:114810783-114810805 GAGTCTTAGAGGAAAACCCAAGG - Intronic
936913307 2:117614759-117614781 GTCTCAGAGACAAGAACCCATGG + Intergenic
936959731 2:118060545-118060567 TCCATTGAGAGAAAAACTCATGG + Intergenic
937195096 2:120147340-120147362 GCCCCTTAGAAAAAAAACCAGGG - Intronic
937469289 2:122161471-122161493 GCCACTTAGAAAAAAACACATGG - Intergenic
940297786 2:152146393-152146415 GGTACTGAGAGCAAAACCCAAGG + Intronic
942112815 2:172699786-172699808 CCCTCTACGAGAAACACCCAAGG - Intergenic
942510794 2:176697739-176697761 GAGGCTCAGAGAAAAACCCAAGG - Intergenic
944738610 2:202590288-202590310 TCCTCAGAGAGAAGAACCAAAGG - Intergenic
944928235 2:204487637-204487659 GCCTCAAAGAGAATAACCCAAGG - Intergenic
945928375 2:215829336-215829358 CCCGCTGAGAGCAAATCCCACGG - Intergenic
946175936 2:217922111-217922133 GCCTCTGAGAGACAGAGCCCAGG + Intronic
946249595 2:218404496-218404518 GCCTTTGTTAGGAAAACCCATGG + Exonic
947625487 2:231615672-231615694 GCCTCTGAGAGCAAAAAAGAGGG - Intergenic
1170025196 20:11881652-11881674 GCTTCTGTGGGAAAAACCAATGG - Intergenic
1170057929 20:12227510-12227532 GCCTCTGAGAGTAGGACCCAGGG + Intergenic
1170376797 20:15709054-15709076 TCCTCTCAGAGAAAAACTCCTGG - Intronic
1172024448 20:31938342-31938364 GGTTCTCAGAGGAAAACCCAAGG + Intronic
1172106512 20:32520317-32520339 GCCTCTGATAAGTAAACCCACGG - Intronic
1175130180 20:56782779-56782801 GCCTCTGGGATAAAAATCCCAGG + Intergenic
1176295784 21:5071630-5071652 AACTCTCAGACAAAAACCCAGGG + Intergenic
1179045959 21:37845224-37845246 ACCTCTGATATAAAAACCCTTGG - Intronic
1179204640 21:39263470-39263492 GGCTCTGAGAGTCAAACCTAAGG + Intronic
1179623818 21:42636209-42636231 GCCTCTGGGAGAAGAAGCCAGGG - Intergenic
1179794617 21:43775899-43775921 GTCTCTGAGAGGAAACCCCAGGG - Intronic
1179861262 21:44190494-44190516 AACTCTCAGACAAAAACCCAGGG - Intergenic
1181542404 22:23580370-23580392 GCCTCTGGGACAGAACCCCAGGG - Intergenic
1181546454 22:23605312-23605334 GCCTCTGAGGGAAAGGCCCTGGG - Intergenic
1181937180 22:26447278-26447300 GAAGCTGAGAGAGAAACCCACGG + Intronic
1182076763 22:27500203-27500225 GCCTCTGGGAGGGAGACCCAGGG - Intergenic
1182718386 22:32377961-32377983 GTCTCTGAGAAAATCACCCATGG - Intronic
1183405326 22:37627727-37627749 GCCTCTGAGAGGAAAACAGAAGG - Intronic
1184857185 22:47152756-47152778 GCCTCTGAGAGAGAAAGCATCGG + Intronic
1184956037 22:47886440-47886462 GCCTCTGTTAGAGCAACCCATGG - Intergenic
949940070 3:9148043-9148065 GCCAGTGAGAGAAATACCCACGG + Intronic
950607061 3:14091367-14091389 CCCTCTTTGAGAAACACCCACGG - Intergenic
952159832 3:30682398-30682420 GCCTCTAAGAGAAAAAGCGAAGG - Intronic
952232117 3:31442981-31443003 GCTGCTGAGAGAAAAACCTCTGG - Intergenic
955047488 3:55373840-55373862 GTCTCAGACAGAGAAACCCAAGG + Intergenic
956727677 3:72169941-72169963 GCCTCTAAGACCAAGACCCACGG + Intergenic
968095556 3:195927707-195927729 CCCTCTTTGAGAAACACCCACGG - Intergenic
968387189 4:151924-151946 CCCTCTTTGAGAAACACCCACGG - Intronic
968577718 4:1375750-1375772 GCCTCTGAGAGGAGCCCCCAGGG + Intronic
968654031 4:1771008-1771030 TCCTCCGAGTGAAAAGCCCAGGG - Intergenic
969565923 4:7978116-7978138 TCCTCTGAAAGAAAAACACCAGG + Intronic
969717270 4:8873796-8873818 GCCTCTCACAGACAGACCCAGGG - Intergenic
971047757 4:22824601-22824623 TACTCTGAGAGAAAAACCGAAGG - Intergenic
971143331 4:23948529-23948551 GCCTCCTAGAGAGAAACCAAAGG - Intergenic
972323886 4:37996912-37996934 CCCTCACAGACAAAAACCCATGG - Intronic
975457973 4:74615654-74615676 GCTTCTGAGAGAAAAGCAGATGG - Intergenic
975661166 4:76689898-76689920 GCCTCTCTGATAAAAAGCCAAGG - Intronic
976025652 4:80685299-80685321 ATCTCTGAGGGAAAAATCCAGGG + Intronic
979622003 4:122808729-122808751 GCCTGTGAAAGAAAAATCAAAGG + Intergenic
980101578 4:128546713-128546735 GCCTCTGAAAAAGAAATCCAAGG - Intergenic
981268670 4:142818373-142818395 GCCTCTGAGAGAAAAACCCATGG - Intronic
981548035 4:145914815-145914837 CCCTCTTAGTGAAAACCCCAAGG - Intronic
983014356 4:162592854-162592876 GCCATTGAGAGCAAAACCTAAGG - Intergenic
985581465 5:697561-697583 GCCTCTGAAAGCCACACCCAGGG - Intergenic
988821336 5:34889343-34889365 GGCTCTCAGGGAAAAACACATGG - Intronic
988934254 5:36066725-36066747 GCCTCTGAGAGCAGGACCCCAGG + Exonic
990151509 5:52823135-52823157 GCCTCGGAGAGAGATACTCATGG + Intronic
992985939 5:82229809-82229831 GCCACAGATAGCAAAACCCATGG - Intronic
993026670 5:82654933-82654955 GACTCTGAGACAAAAACTGAGGG - Intergenic
993570178 5:89526939-89526961 GACTCTGAGATAAAAGCACAGGG + Intergenic
994955796 5:106530306-106530328 GCCTCTGAGAGTAAATTCAATGG - Intergenic
997214519 5:132099658-132099680 GCTGCTCAGAGAAAAACCCTTGG + Intergenic
997417200 5:133738249-133738271 TCCTCAGAGAGAAAACTCCAAGG - Intergenic
998135121 5:139670375-139670397 GCCTCTGAGAAACCAACCCAGGG - Intronic
1002290995 5:178200779-178200801 GCCTCTGGCAGAAACACCCTTGG + Intergenic
1002606987 5:180389401-180389423 GCCTCTCAGAGAAGGGCCCATGG - Intergenic
1003565147 6:7216309-7216331 GCCTCTGATGTAAAATCCCAAGG - Intronic
1005346031 6:24891712-24891734 GCCTCTGAGAGGGGAACCAATGG - Intronic
1005810358 6:29510698-29510720 GCCTGGGAGAGATGAACCCATGG + Intergenic
1005920073 6:30393389-30393411 GCCTCTGAGAGAAAATCTCCAGG - Intergenic
1006247227 6:32747931-32747953 GCCTATGAGAGAGAAATCCTAGG + Intergenic
1006287929 6:33112363-33112385 GACTCTGAGAAAAGAACCAATGG - Intergenic
1007077172 6:39075248-39075270 GCCTCGGGGAGAAAAGGCCAAGG - Intronic
1007684529 6:43657466-43657488 GGCTCAGAGAGTTAAACCCAAGG + Intronic
1009853655 6:69232076-69232098 AACTCTAAGAGAAAAACACATGG - Intronic
1010795457 6:80112658-80112680 ACCTGTGAGAGAAAATTCCAAGG + Intronic
1013825814 6:114210014-114210036 GCCTTTGACAGAAAAATCAAAGG - Intronic
1016337137 6:143018955-143018977 GCCACCTGGAGAAAAACCCAAGG - Intergenic
1018092556 6:160357484-160357506 GCTTCTGAGACAGAAACCGAAGG + Intronic
1018320661 6:162604740-162604762 ACCTCTGACAGTAAAACCCCAGG + Intronic
1019604329 7:1901010-1901032 CCCTCTGACAGACAAACCCAGGG + Intronic
1020027778 7:4911245-4911267 GCCTGGGAGAGAAAGAGCCAAGG + Exonic
1020354082 7:7257933-7257955 CCCTCTGATACCAAAACCCATGG - Intergenic
1020924385 7:14306651-14306673 GCCTCTTAAAAGAAAACCCATGG - Intronic
1021481228 7:21119818-21119840 TCCTCTGAAAGAAAAACAAAAGG + Intergenic
1022483833 7:30762228-30762250 GTCTCTCACATAAAAACCCAGGG - Intronic
1025150769 7:56546108-56546130 TCCTCTCAAAGAAAAGCCCAGGG + Intergenic
1025738115 7:64172428-64172450 TCCTCTCAAAGAAAAGCCCAGGG - Intronic
1028996469 7:97105631-97105653 GCCTGTGAGAGAAAGAACAAGGG + Intergenic
1034126043 7:148672361-148672383 CCCTCAGAGAGAGAAATCCAAGG + Intergenic
1034345164 7:150381502-150381524 GACTCTGAGAGACATTCCCAAGG - Intronic
1034490080 7:151388497-151388519 GCTTCTAAGCGACAAACCCAAGG - Intronic
1036087385 8:5627020-5627042 GCCTGGGGGAGAAAATCCCAAGG + Intergenic
1038989931 8:32857111-32857133 GCCTCAGTAAGAAAAGCCCAGGG + Intergenic
1044558405 8:93589256-93589278 GCTGCTCAGAGAAAAACGCAGGG + Intergenic
1046017582 8:108623768-108623790 TCCCATGAGAGAAAAATCCAGGG - Intronic
1047618971 8:126587032-126587054 GCTTCAGATAGATAAACCCATGG + Intergenic
1049332704 8:142063660-142063682 GCTCCTGGGAGGAAAACCCAGGG + Intergenic
1050526186 9:6548826-6548848 ACCTTTGAGAGAAAAACAGATGG - Intronic
1053946236 9:43312153-43312175 GCCTCAGCGGCAAAAACCCACGG - Intergenic
1057904113 9:98971311-98971333 GGCTCTGGGAGGAAAACACATGG - Intronic
1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG + Intronic
1061237634 9:129351852-129351874 GCCCCAGAGAGAAAAGACCAGGG - Intergenic
1061452998 9:130678659-130678681 GCCGCTGAGACACAGACCCATGG + Intronic
1203589366 Un_KI270747v1:40711-40733 GCCTCAGCGGCAAAAACCCACGG - Intergenic
1189272195 X:39759562-39759584 GCGTTTGTGAGGAAAACCCAGGG + Intergenic
1190455046 X:50618862-50618884 GTCTCTGAGAGATAATCGCAGGG + Intronic
1190907001 X:54737352-54737374 CCCTCTCTGAGAAACACCCAAGG + Intergenic
1191885434 X:65883257-65883279 GCCTCCTAAAGAAAAATCCAAGG + Intergenic
1192430388 X:71107706-71107728 TCCTCTGACAGAAGAACCCCAGG - Exonic
1196780960 X:119383809-119383831 TCCTCTGAGGGGTAAACCCAAGG + Intergenic
1197933819 X:131720496-131720518 AACTCTGAGAGAAAATTCCAAGG - Intergenic
1198031907 X:132761394-132761416 CCCACTGAGAGAGAAACCCCAGG + Intronic
1198362624 X:135910730-135910752 GCATCTGAGAGATATACCTATGG + Intronic
1200023870 X:153238455-153238477 TCCTCTGCCAGCAAAACCCAGGG + Intergenic