ID: 981272509

View in Genome Browser
Species Human (GRCh38)
Location 4:142861030-142861052
Sequence AAGTAGTGCCTCAATGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981272507_981272509 25 Left 981272507 4:142860982-142861004 CCTGCAGAGGACAGCCATTCTGA No data
Right 981272509 4:142861030-142861052 AAGTAGTGCCTCAATGAAGAAGG No data
981272508_981272509 11 Left 981272508 4:142860996-142861018 CCATTCTGATACTTATCAAGTTA No data
Right 981272509 4:142861030-142861052 AAGTAGTGCCTCAATGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981272509 Original CRISPR AAGTAGTGCCTCAATGAAGA AGG Intergenic
No off target data available for this crispr