ID: 981276223

View in Genome Browser
Species Human (GRCh38)
Location 4:142900894-142900916
Sequence CTGTGGTTGGGGGAGGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981276212_981276223 17 Left 981276212 4:142900854-142900876 CCATGTGTGAGCGCATGCAGGCC No data
Right 981276223 4:142900894-142900916 CTGTGGTTGGGGGAGGCCACAGG No data
981276215_981276223 -4 Left 981276215 4:142900875-142900897 CCAAGCAACTCCAAGGAGGCTGT No data
Right 981276223 4:142900894-142900916 CTGTGGTTGGGGGAGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981276223 Original CRISPR CTGTGGTTGGGGGAGGCCAC AGG Intergenic
No off target data available for this crispr