ID: 981276612

View in Genome Browser
Species Human (GRCh38)
Location 4:142906041-142906063
Sequence TTGGTAACACAGATATACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981276612_981276616 14 Left 981276612 4:142906041-142906063 CCTTGGTATATCTGTGTTACCAA No data
Right 981276616 4:142906078-142906100 TTTTAATCTCTTATTTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981276612 Original CRISPR TTGGTAACACAGATATACCA AGG (reversed) Intergenic
No off target data available for this crispr