ID: 981281997

View in Genome Browser
Species Human (GRCh38)
Location 4:142969188-142969210
Sequence CTGTAGGCAAATTGTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981281994_981281997 -8 Left 981281994 4:142969173-142969195 CCATGAGGAATTTCTCTGTAGGC No data
Right 981281997 4:142969188-142969210 CTGTAGGCAAATTGTGAGGAGGG No data
981281992_981281997 -7 Left 981281992 4:142969172-142969194 CCCATGAGGAATTTCTCTGTAGG No data
Right 981281997 4:142969188-142969210 CTGTAGGCAAATTGTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981281997 Original CRISPR CTGTAGGCAAATTGTGAGGA GGG Intergenic
No off target data available for this crispr