ID: 981284384

View in Genome Browser
Species Human (GRCh38)
Location 4:142998252-142998274
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981284384_981284394 22 Left 981284384 4:142998252-142998274 CCTCCCACCTCAGCCTCTTACAG No data
Right 981284394 4:142998297-142998319 CACTGTGCTTGGCCAAAAAAGGG No data
981284384_981284390 -8 Left 981284384 4:142998252-142998274 CCTCCCACCTCAGCCTCTTACAG No data
Right 981284390 4:142998267-142998289 TCTTACAGGTCTGAGATTACAGG No data
981284384_981284393 21 Left 981284384 4:142998252-142998274 CCTCCCACCTCAGCCTCTTACAG No data
Right 981284393 4:142998296-142998318 GCACTGTGCTTGGCCAAAAAAGG No data
981284384_981284391 -1 Left 981284384 4:142998252-142998274 CCTCCCACCTCAGCCTCTTACAG No data
Right 981284391 4:142998274-142998296 GGTCTGAGATTACAGGTGTGAGG No data
981284384_981284392 11 Left 981284384 4:142998252-142998274 CCTCCCACCTCAGCCTCTTACAG No data
Right 981284392 4:142998286-142998308 CAGGTGTGAGGCACTGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981284384 Original CRISPR CTGTAAGAGGCTGAGGTGGG AGG (reversed) Intergenic