ID: 981284384

View in Genome Browser
Species Human (GRCh38)
Location 4:142998252-142998274
Sequence CTGTAAGAGGCTGAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132437
Summary {0: 2, 1: 93, 2: 2639, 3: 32793, 4: 96910}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981284384_981284390 -8 Left 981284384 4:142998252-142998274 CCTCCCACCTCAGCCTCTTACAG 0: 2
1: 93
2: 2639
3: 32793
4: 96910
Right 981284390 4:142998267-142998289 TCTTACAGGTCTGAGATTACAGG No data
981284384_981284393 21 Left 981284384 4:142998252-142998274 CCTCCCACCTCAGCCTCTTACAG 0: 2
1: 93
2: 2639
3: 32793
4: 96910
Right 981284393 4:142998296-142998318 GCACTGTGCTTGGCCAAAAAAGG No data
981284384_981284391 -1 Left 981284384 4:142998252-142998274 CCTCCCACCTCAGCCTCTTACAG 0: 2
1: 93
2: 2639
3: 32793
4: 96910
Right 981284391 4:142998274-142998296 GGTCTGAGATTACAGGTGTGAGG No data
981284384_981284392 11 Left 981284384 4:142998252-142998274 CCTCCCACCTCAGCCTCTTACAG 0: 2
1: 93
2: 2639
3: 32793
4: 96910
Right 981284392 4:142998286-142998308 CAGGTGTGAGGCACTGTGCTTGG 0: 4
1: 408
2: 7915
3: 31094
4: 79718
981284384_981284394 22 Left 981284384 4:142998252-142998274 CCTCCCACCTCAGCCTCTTACAG 0: 2
1: 93
2: 2639
3: 32793
4: 96910
Right 981284394 4:142998297-142998319 CACTGTGCTTGGCCAAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981284384 Original CRISPR CTGTAAGAGGCTGAGGTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr