ID: 981284386

View in Genome Browser
Species Human (GRCh38)
Location 4:142998255-142998277
Sequence GACCTGTAAGAGGCTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981284386_981284392 8 Left 981284386 4:142998255-142998277 CCCACCTCAGCCTCTTACAGGTC No data
Right 981284392 4:142998286-142998308 CAGGTGTGAGGCACTGTGCTTGG 0: 4
1: 408
2: 7915
3: 31094
4: 79718
981284386_981284393 18 Left 981284386 4:142998255-142998277 CCCACCTCAGCCTCTTACAGGTC No data
Right 981284393 4:142998296-142998318 GCACTGTGCTTGGCCAAAAAAGG No data
981284386_981284391 -4 Left 981284386 4:142998255-142998277 CCCACCTCAGCCTCTTACAGGTC No data
Right 981284391 4:142998274-142998296 GGTCTGAGATTACAGGTGTGAGG No data
981284386_981284394 19 Left 981284386 4:142998255-142998277 CCCACCTCAGCCTCTTACAGGTC No data
Right 981284394 4:142998297-142998319 CACTGTGCTTGGCCAAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981284386 Original CRISPR GACCTGTAAGAGGCTGAGGT GGG (reversed) Intergenic
No off target data available for this crispr