ID: 981284390

View in Genome Browser
Species Human (GRCh38)
Location 4:142998267-142998289
Sequence TCTTACAGGTCTGAGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981284383_981284390 3 Left 981284383 4:142998241-142998263 CCTCAAGCAATCCTCCCACCTCA No data
Right 981284390 4:142998267-142998289 TCTTACAGGTCTGAGATTACAGG No data
981284380_981284390 26 Left 981284380 4:142998218-142998240 CCAGGCTGGTCTTGAACTCCTGG No data
Right 981284390 4:142998267-142998289 TCTTACAGGTCTGAGATTACAGG No data
981284384_981284390 -8 Left 981284384 4:142998252-142998274 CCTCCCACCTCAGCCTCTTACAG No data
Right 981284390 4:142998267-142998289 TCTTACAGGTCTGAGATTACAGG No data
981284382_981284390 8 Left 981284382 4:142998236-142998258 CCTGGCCTCAAGCAATCCTCCCA No data
Right 981284390 4:142998267-142998289 TCTTACAGGTCTGAGATTACAGG No data
981284379_981284390 27 Left 981284379 4:142998217-142998239 CCCAGGCTGGTCTTGAACTCCTG No data
Right 981284390 4:142998267-142998289 TCTTACAGGTCTGAGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981284390 Original CRISPR TCTTACAGGTCTGAGATTAC AGG Intergenic