ID: 981284391

View in Genome Browser
Species Human (GRCh38)
Location 4:142998274-142998296
Sequence GGTCTGAGATTACAGGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981284387_981284391 -5 Left 981284387 4:142998256-142998278 CCACCTCAGCCTCTTACAGGTCT No data
Right 981284391 4:142998274-142998296 GGTCTGAGATTACAGGTGTGAGG No data
981284388_981284391 -8 Left 981284388 4:142998259-142998281 CCTCAGCCTCTTACAGGTCTGAG No data
Right 981284391 4:142998274-142998296 GGTCTGAGATTACAGGTGTGAGG No data
981284382_981284391 15 Left 981284382 4:142998236-142998258 CCTGGCCTCAAGCAATCCTCCCA 0: 1415
1: 10967
2: 32079
3: 67627
4: 115770
Right 981284391 4:142998274-142998296 GGTCTGAGATTACAGGTGTGAGG No data
981284384_981284391 -1 Left 981284384 4:142998252-142998274 CCTCCCACCTCAGCCTCTTACAG 0: 2
1: 93
2: 2639
3: 32793
4: 96910
Right 981284391 4:142998274-142998296 GGTCTGAGATTACAGGTGTGAGG No data
981284386_981284391 -4 Left 981284386 4:142998255-142998277 CCCACCTCAGCCTCTTACAGGTC No data
Right 981284391 4:142998274-142998296 GGTCTGAGATTACAGGTGTGAGG No data
981284383_981284391 10 Left 981284383 4:142998241-142998263 CCTCAAGCAATCCTCCCACCTCA 0: 830
1: 2712
2: 7685
3: 17936
4: 42194
Right 981284391 4:142998274-142998296 GGTCTGAGATTACAGGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981284391 Original CRISPR GGTCTGAGATTACAGGTGTG AGG Intergenic
No off target data available for this crispr