ID: 981284392

View in Genome Browser
Species Human (GRCh38)
Location 4:142998286-142998308
Sequence CAGGTGTGAGGCACTGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981284388_981284392 4 Left 981284388 4:142998259-142998281 CCTCAGCCTCTTACAGGTCTGAG No data
Right 981284392 4:142998286-142998308 CAGGTGTGAGGCACTGTGCTTGG No data
981284386_981284392 8 Left 981284386 4:142998255-142998277 CCCACCTCAGCCTCTTACAGGTC No data
Right 981284392 4:142998286-142998308 CAGGTGTGAGGCACTGTGCTTGG No data
981284387_981284392 7 Left 981284387 4:142998256-142998278 CCACCTCAGCCTCTTACAGGTCT No data
Right 981284392 4:142998286-142998308 CAGGTGTGAGGCACTGTGCTTGG No data
981284383_981284392 22 Left 981284383 4:142998241-142998263 CCTCAAGCAATCCTCCCACCTCA No data
Right 981284392 4:142998286-142998308 CAGGTGTGAGGCACTGTGCTTGG No data
981284384_981284392 11 Left 981284384 4:142998252-142998274 CCTCCCACCTCAGCCTCTTACAG No data
Right 981284392 4:142998286-142998308 CAGGTGTGAGGCACTGTGCTTGG No data
981284382_981284392 27 Left 981284382 4:142998236-142998258 CCTGGCCTCAAGCAATCCTCCCA No data
Right 981284392 4:142998286-142998308 CAGGTGTGAGGCACTGTGCTTGG No data
981284389_981284392 -2 Left 981284389 4:142998265-142998287 CCTCTTACAGGTCTGAGATTACA No data
Right 981284392 4:142998286-142998308 CAGGTGTGAGGCACTGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981284392 Original CRISPR CAGGTGTGAGGCACTGTGCT TGG Intergenic