ID: 981284393

View in Genome Browser
Species Human (GRCh38)
Location 4:142998296-142998318
Sequence GCACTGTGCTTGGCCAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981284387_981284393 17 Left 981284387 4:142998256-142998278 CCACCTCAGCCTCTTACAGGTCT No data
Right 981284393 4:142998296-142998318 GCACTGTGCTTGGCCAAAAAAGG No data
981284388_981284393 14 Left 981284388 4:142998259-142998281 CCTCAGCCTCTTACAGGTCTGAG No data
Right 981284393 4:142998296-142998318 GCACTGTGCTTGGCCAAAAAAGG No data
981284384_981284393 21 Left 981284384 4:142998252-142998274 CCTCCCACCTCAGCCTCTTACAG 0: 2
1: 93
2: 2639
3: 32793
4: 96910
Right 981284393 4:142998296-142998318 GCACTGTGCTTGGCCAAAAAAGG No data
981284386_981284393 18 Left 981284386 4:142998255-142998277 CCCACCTCAGCCTCTTACAGGTC No data
Right 981284393 4:142998296-142998318 GCACTGTGCTTGGCCAAAAAAGG No data
981284389_981284393 8 Left 981284389 4:142998265-142998287 CCTCTTACAGGTCTGAGATTACA No data
Right 981284393 4:142998296-142998318 GCACTGTGCTTGGCCAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981284393 Original CRISPR GCACTGTGCTTGGCCAAAAA AGG Intergenic
No off target data available for this crispr