ID: 981290008

View in Genome Browser
Species Human (GRCh38)
Location 4:143063601-143063623
Sequence CAATTGCATCAGATTATCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981290008_981290013 21 Left 981290008 4:143063601-143063623 CCTTGGATAATCTGATGCAATTG No data
Right 981290013 4:143063645-143063667 TCTGCTGTGACAGGTACCCTGGG No data
981290008_981290011 12 Left 981290008 4:143063601-143063623 CCTTGGATAATCTGATGCAATTG No data
Right 981290011 4:143063636-143063658 ACAAAAGAATCTGCTGTGACAGG No data
981290008_981290012 20 Left 981290008 4:143063601-143063623 CCTTGGATAATCTGATGCAATTG No data
Right 981290012 4:143063644-143063666 ATCTGCTGTGACAGGTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981290008 Original CRISPR CAATTGCATCAGATTATCCA AGG (reversed) Intergenic
No off target data available for this crispr