ID: 981292285

View in Genome Browser
Species Human (GRCh38)
Location 4:143090167-143090189
Sequence TTGGACCCCCAAAATCACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981292280_981292285 9 Left 981292280 4:143090135-143090157 CCCCTGGATACACTTTGTGAAAG No data
Right 981292285 4:143090167-143090189 TTGGACCCCCAAAATCACTAAGG No data
981292283_981292285 7 Left 981292283 4:143090137-143090159 CCTGGATACACTTTGTGAAAGGA No data
Right 981292285 4:143090167-143090189 TTGGACCCCCAAAATCACTAAGG No data
981292279_981292285 14 Left 981292279 4:143090130-143090152 CCATACCCCTGGATACACTTTGT No data
Right 981292285 4:143090167-143090189 TTGGACCCCCAAAATCACTAAGG No data
981292281_981292285 8 Left 981292281 4:143090136-143090158 CCCTGGATACACTTTGTGAAAGG No data
Right 981292285 4:143090167-143090189 TTGGACCCCCAAAATCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981292285 Original CRISPR TTGGACCCCCAAAATCACTA AGG Intergenic
No off target data available for this crispr