ID: 981296652

View in Genome Browser
Species Human (GRCh38)
Location 4:143140632-143140654
Sequence TTGACTTCAGACTGCTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1733
Summary {0: 12, 1: 225, 2: 418, 3: 604, 4: 474}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981296652_981296664 24 Left 981296652 4:143140632-143140654 CCAGTACAGCAGTCTGAAGTCAA 0: 12
1: 225
2: 418
3: 604
4: 474
Right 981296664 4:143140679-143140701 GGAGGGGCCCACCATTACAGAGG No data
981296652_981296663 8 Left 981296652 4:143140632-143140654 CCAGTACAGCAGTCTGAAGTCAA 0: 12
1: 225
2: 418
3: 604
4: 474
Right 981296663 4:143140663-143140685 ACTGGAGCTTTGTGGGGGAGGGG No data
981296652_981296659 2 Left 981296652 4:143140632-143140654 CCAGTACAGCAGTCTGAAGTCAA 0: 12
1: 225
2: 418
3: 604
4: 474
Right 981296659 4:143140657-143140679 TGGGACACTGGAGCTTTGTGGGG No data
981296652_981296655 -10 Left 981296652 4:143140632-143140654 CCAGTACAGCAGTCTGAAGTCAA 0: 12
1: 225
2: 418
3: 604
4: 474
Right 981296655 4:143140645-143140667 CTGAAGTCAACCTGGGACACTGG 0: 6
1: 13
2: 33
3: 85
4: 235
981296652_981296661 6 Left 981296652 4:143140632-143140654 CCAGTACAGCAGTCTGAAGTCAA 0: 12
1: 225
2: 418
3: 604
4: 474
Right 981296661 4:143140661-143140683 ACACTGGAGCTTTGTGGGGGAGG No data
981296652_981296657 0 Left 981296652 4:143140632-143140654 CCAGTACAGCAGTCTGAAGTCAA 0: 12
1: 225
2: 418
3: 604
4: 474
Right 981296657 4:143140655-143140677 CCTGGGACACTGGAGCTTTGTGG No data
981296652_981296662 7 Left 981296652 4:143140632-143140654 CCAGTACAGCAGTCTGAAGTCAA 0: 12
1: 225
2: 418
3: 604
4: 474
Right 981296662 4:143140662-143140684 CACTGGAGCTTTGTGGGGGAGGG No data
981296652_981296660 3 Left 981296652 4:143140632-143140654 CCAGTACAGCAGTCTGAAGTCAA 0: 12
1: 225
2: 418
3: 604
4: 474
Right 981296660 4:143140658-143140680 GGGACACTGGAGCTTTGTGGGGG No data
981296652_981296658 1 Left 981296652 4:143140632-143140654 CCAGTACAGCAGTCTGAAGTCAA 0: 12
1: 225
2: 418
3: 604
4: 474
Right 981296658 4:143140656-143140678 CTGGGACACTGGAGCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981296652 Original CRISPR TTGACTTCAGACTGCTGTAC TGG (reversed) Intergenic
902141585 1:14361307-14361329 TCAACCTCAGACTGCTGTGCTGG + Intergenic
902965102 1:19995427-19995449 TTGACTTCAAACAGCTGTGCTGG + Intergenic
903566917 1:24274624-24274646 TCGACTTCAGGCTGCTGTGCTGG + Intergenic
905044312 1:34984302-34984324 TTCTCTTAAGGCTGCTGTACAGG + Intronic
906557851 1:46728609-46728631 TGGACTTCAGACTGCTGTGCTGG - Intergenic
906586751 1:46984974-46984996 TTGACCTCAGACTCCTGTGCTGG - Intergenic
906739949 1:48173094-48173116 ATGACTTCCGACTGCTGTGCTGG + Intergenic
906753237 1:48285302-48285324 TTGACTTCAGACTGCTGTGCTGG + Intergenic
907565636 1:55430830-55430852 TCAACTTCAGACTGCCGTGCTGG - Intergenic
907600122 1:55760645-55760667 TCGAGCTCAGACTGCTGTGCTGG - Intergenic
907953540 1:59206751-59206773 TTGACTTCAGACTGCTGTGCTGG - Intergenic
908111825 1:60905422-60905444 TTGACCTCAGACTGGTGACCAGG + Intronic
908598279 1:65711416-65711438 TTGACTTCAGACTGCTGTGCTGG + Intergenic
908601404 1:65744073-65744095 TTGACTTCAGACTGCTGTGCTGG + Intergenic
908903838 1:68985615-68985637 TCAACTTCAGACTGCTGTGCTGG - Intergenic
909149737 1:71986858-71986880 TTGCCTTAAGACTTTTGTACTGG - Intronic
909211514 1:72830712-72830734 CTGACTCCAGACTGCTGTGCTGG - Intergenic
909384234 1:75036933-75036955 TGGACTTCAGACTGCTGTGATGG - Intergenic
909493134 1:76247695-76247717 TTGACTCTGGACTGCTGTGCTGG + Intronic
909536424 1:76741511-76741533 TCGACTTCAGACCACTGTGCTGG + Intergenic
909690142 1:78398100-78398122 TAGACTTCAGACTGCTGTGCTGG + Intronic
909826945 1:80138169-80138191 TTGATCTCAGACTGCTGGGCTGG + Intergenic
909874359 1:80783808-80783830 TTGACTTCAGACTACCGTGCTGG - Intergenic
910177206 1:84443336-84443358 TTGACTTCAGACTGCTGTGCTGG - Intergenic
910330998 1:86072276-86072298 TCGATATCAGACTGCTGTGCTGG - Intronic
910604846 1:89072141-89072163 TCAACTTCAGACTGCTGTGCTGG - Intergenic
910626921 1:89316891-89316913 TTGACTTTAGGCTGCTGCACTGG - Intergenic
910635712 1:89405326-89405348 TCAACTTCAGACTGCTGTGCTGG + Intergenic
910668813 1:89752647-89752669 TTGATCTCAGACTGCTGTGCTGG + Intronic
910799525 1:91131518-91131540 TTGACTTCAGACTGCTGTGCTGG - Intergenic
910805736 1:91188512-91188534 TCGACTTCAGACTGCTGTGCTGG + Intergenic
911120646 1:94293225-94293247 TTGATCTCAGACTGCTGCGCTGG + Intergenic
911270653 1:95797480-95797502 TTGACTTCATACTGCTCTGCTGG - Intergenic
911530696 1:99039807-99039829 TTGACTTCTTACTGCTGTGCTGG - Intergenic
911632650 1:100200173-100200195 TCGACTTCAGACTGCTGTGCTGG - Intronic
911692048 1:100845514-100845536 TCGACTTCAGACTGCTGTGTTGG + Intergenic
912076728 1:105884562-105884584 TTGACCTCAGACTGATGTGCTGG + Intergenic
912150516 1:106853517-106853539 TGGACTTCAGACTGCTGTGCTGG - Intergenic
912235335 1:107844587-107844609 TCGACTTCAGACTGCTGTGCTGG - Intronic
912276302 1:108262113-108262135 CGGACTCCAGACTGCTGTGCCGG - Intergenic
912291926 1:108432245-108432267 CGGACTCCAGACTGCTGTGCCGG + Intronic
912301398 1:108520613-108520635 TTGACTTCAGACTGCTGTGCTGG + Intergenic
912894879 1:113576064-113576086 TGGACTTCAGACTGCTGTGCTGG + Intronic
913021454 1:114792210-114792232 TTGACATCAGACTGCTGGACTGG + Intergenic
913036301 1:114969518-114969540 TTGACTTTAGACTGCTGTTTTGG + Intronic
913108660 1:115639346-115639368 TCGACTTCAGACTGCTGTGCTGG + Intergenic
913430107 1:118781152-118781174 TTGACTTCACACTGCTGTGCTGG + Intergenic
913507060 1:119526752-119526774 TTGACTTCAGAATGCTGTGCTGG + Intergenic
915061369 1:153188553-153188575 TCAACTTCAGACAGCTGTGCTGG + Intergenic
915649077 1:157294492-157294514 TCAACTTCAGACTGCTGTGCTGG - Intergenic
915654493 1:157348144-157348166 TTGACTTCAGACTGCTGTGCTGG + Intergenic
915771776 1:158432906-158432928 TCGACTACAGACTGCTGTGCTGG + Intergenic
915845569 1:159260407-159260429 TTGACTTCAGTTCTCTGTACAGG + Intergenic
915876520 1:159616641-159616663 TTGACTTCAGACTGCTCTGCTGG - Intergenic
915886793 1:159730828-159730850 TTGATCTCAGACTGCTGTGCTGG - Intergenic
915921894 1:159981950-159981972 GAGACTTCAGACTGCAGTGCAGG - Intergenic
915992268 1:160529823-160529845 TCGGCTTCAGACTGCTGTGCTGG + Intergenic
916140544 1:161693414-161693436 TCTACTTCAGACTGCTGTGCTGG - Intergenic
916359547 1:163952820-163952842 TCGACCTCAGACTGCTGTGCTGG - Intergenic
916612800 1:166409775-166409797 TCAACTTCAGACTGCTGTGCTGG + Intergenic
916614859 1:166429323-166429345 TCAACTTCAGACTGCTGTGCTGG + Intergenic
916625602 1:166552293-166552315 TTGACTTCAGACTGCTGTGCTGG + Intergenic
916878724 1:168998445-168998467 TCGACTTCAGACTGCTGTGCTGG + Intergenic
916903622 1:169257182-169257204 TTGATCTCAGACTGCTGTGCTGG + Intronic
916916094 1:169408185-169408207 TCGACTTCAGACTGCTGTGCTGG - Intronic
916938544 1:169656531-169656553 CCAACTTCAGACTGCTGTGCTGG - Intergenic
916973443 1:170049092-170049114 TCAACTCCAGACTGCTGTGCTGG - Intronic
917007047 1:170426725-170426747 TCGACTTCAGACTGCTGTGCTGG - Intergenic
917009772 1:170457935-170457957 TCTACTTCAGACTGCTGTGCTGG + Intergenic
917019374 1:170569441-170569463 TCAACTTTAGACTGCTGTGCTGG - Intergenic
917091733 1:171359802-171359824 TCTACTTCAGACTGCTGTGCTGG - Intergenic
917157941 1:172025068-172025090 TCAACTTCAGACTGCTGTGCTGG - Intronic
917163147 1:172080498-172080520 CCAACTTCAGACTGCTGTGCTGG + Intronic
917274628 1:173319110-173319132 TTGACTTCAGATTTCTGTGCTGG - Intergenic
917357756 1:174144137-174144159 TCGACTTCAGACTGCTGTGCTGG - Intergenic
917405968 1:174708939-174708961 TTGACTTCAGAATGCTGTGCTGG - Intronic
917584982 1:176417043-176417065 ACGACCTCAGACTGCTGTGCTGG + Intergenic
917768585 1:178250447-178250469 TCGACTTCAGACTGCTGTCCTGG + Intronic
917915215 1:179694616-179694638 TCGAGCTCAGACTGCTGTGCTGG - Intergenic
918160019 1:181889641-181889663 TCAACTTCAGACTGCTGTGCTGG - Intergenic
918163359 1:181921001-181921023 TTGACTTCAGAATGCTGTGCTGG - Intergenic
918167243 1:181961800-181961822 TCGACTTCAGACCGCTATACTGG + Intergenic
918195653 1:182219044-182219066 TCGACTTTAGACTGCTGTGCTGG - Intergenic
918353676 1:183684462-183684484 TCGACTCCAGACTGCTGTGCTGG + Intronic
918360398 1:183751423-183751445 TTGACTTCAGACTGCTGTGCTGG + Intronic
918501502 1:185201124-185201146 TTGACTTCAGACTGCTGTGCTGG + Intronic
918632093 1:186730474-186730496 TTGACTTCAGACTGCTGTGCTGG + Intergenic
918823350 1:189288487-189288509 CTCACTTCAGACTGCTGCAAGGG + Intergenic
919146779 1:193645268-193645290 TCAACTTCAGACTGTTGTGCTGG + Intergenic
919454179 1:197802717-197802739 TTGATCTCAGACTGCTGTGCTGG - Intergenic
919598992 1:199599733-199599755 TTGACTTCAGACTGCTGTGCTGG - Intergenic
919601890 1:199633109-199633131 TTGACTTCAGACTGCTGTGCTGG - Intergenic
920985587 1:210885660-210885682 TGGACTTCAGACTGCTGTGCTGG - Intronic
921296855 1:213712388-213712410 TCAACTTCAGACTGCTGTGCTGG + Intergenic
921401385 1:214727521-214727543 TCGAGCTCAGACTGCTGTGCTGG + Intergenic
921484860 1:215703686-215703708 TTGACTTCAGACTGCTGTACTGG + Intronic
921626179 1:217379932-217379954 TCAACTTCAGACTGCTGTGCTGG - Intergenic
921631341 1:217437499-217437521 TCGGCTTCAGACTACTGTGCTGG - Intronic
921962236 1:221047702-221047724 TCGACTTCAGACTGCTGTGCTGG - Intergenic
921976329 1:221207166-221207188 TTGACTTCAGACTGCCGTGCTGG - Intergenic
922066208 1:222146040-222146062 TCGACTTCAGACTGCTGTGCTGG - Intergenic
922380032 1:225013828-225013850 TCGACTTCAGACTGCTGTGCTGG + Intronic
922396793 1:225210277-225210299 TAAACTTCATACTGCTGTGCTGG - Intronic
922397527 1:225217640-225217662 TCGATCTCAGACTGCTGTGCTGG + Intronic
922406224 1:225316225-225316247 TCTTCTTCAGACTGCTGTGCTGG + Intronic
922666537 1:227474164-227474186 TCAACTTCAGACTGCTGTGCTGG - Intergenic
922691911 1:227699896-227699918 TCTATTTCAGACTGCTGTGCTGG - Intergenic
922811794 1:228419992-228420014 TTCAATTCAGACTGCTCAACAGG + Intergenic
923061247 1:230476502-230476524 TCGACTTCAGACTGTAGTGCTGG + Intergenic
923421729 1:233822554-233822576 TTGACTTCAGACTGCTGTGCTGG - Intergenic
924179983 1:241430823-241430845 TCAACTTCAGACTGCTATGCTGG + Intergenic
924296018 1:242587215-242587237 TCGACCTCGGACTGCTGTGCTGG - Intergenic
924494006 1:244568715-244568737 GTCACTTCAGACTGCTGTGCTGG + Intronic
924639161 1:245816920-245816942 TTGATCTCAGACTGCTGTGCTGG - Intronic
924823114 1:247513381-247513403 TCACCTTCAGACTGCTGTACTGG + Intronic
924829014 1:247573044-247573066 TCGACTTCAGACTGCTGTGCTGG + Intronic
1064757850 10:18588042-18588064 TTGACTCCAGACTGCTGTGCTGG - Intronic
1065120997 10:22530349-22530371 CTGACTTCAGACTGCTGTGCTGG + Intergenic
1065427417 10:25619777-25619799 CTGACCTCAGACTGCTGTGCTGG - Intergenic
1065907650 10:30272375-30272397 TTGACTTCAGACTGCTGGGCTGG - Intergenic
1066005461 10:31142789-31142811 ATGACTTTAGAATGCTGTCCAGG - Intergenic
1066159656 10:32714663-32714685 TTGACTTCAGACTGCTGTGCTGG - Intronic
1066257643 10:33696158-33696180 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1066993495 10:42539580-42539602 TTGAGCTCAGACTGCTGGGCTGG + Intergenic
1067162169 10:43836430-43836452 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1067209695 10:44249788-44249810 TCGACTTAAGACTGCTGTGCTGG + Intergenic
1067332270 10:45333498-45333520 TCAACTTCAGACTACTGTGCTGG + Intergenic
1068086102 10:52375101-52375123 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1068357113 10:55923384-55923406 TTGACTTCAGATGGCTGTGCTGG + Intergenic
1068369626 10:56095906-56095928 TCGACTCCAGACTGCTGTGCTGG + Intergenic
1068469960 10:57448352-57448374 TTGGCTTCCGACTGCTCTGCTGG + Intergenic
1068576241 10:58687608-58687630 TCGAGCTCAGACTGCTGTGCTGG + Intronic
1068951566 10:62782574-62782596 TTAACTTCAGACTGCTGTACTGG - Intergenic
1069120826 10:64567339-64567361 TCGACTTCCGACTGCTGTGTTGG + Intergenic
1069139926 10:64810308-64810330 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1069150707 10:64955426-64955448 CTGACTTCAAACTGCACTACAGG + Intergenic
1069348982 10:67502841-67502863 TTGACTTCAGACTGCTGTGCTGG + Intronic
1070234467 10:74609111-74609133 TCGACTTCAGACTGCTGTGCTGG + Intronic
1070347979 10:75564276-75564298 TTGATCTCAGACTGCTGTGCTGG + Intronic
1070999726 10:80818138-80818160 TCAACTTCAGACTGTTGTGCTGG - Intergenic
1071002023 10:80841623-80841645 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1071272416 10:84020182-84020204 TGGACTTCACACTGCTGTGCTGG - Intergenic
1071341306 10:84651522-84651544 TCGACATCAGACTGCTGTGCTGG + Intergenic
1071401788 10:85280257-85280279 TTGACTTCAGACTGCTGTTTTGG + Intergenic
1071740810 10:88355950-88355972 TCGATCTCAGACTGCTGTGCTGG + Intronic
1072044888 10:91644429-91644451 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1072365361 10:94703608-94703630 TCGACTTCAGACTGCTGTGCTGG + Intronic
1072375693 10:94813659-94813681 TCAACTTCAGACTGCTGTGCTGG + Intronic
1072389569 10:94969311-94969333 TCAACTTCAGACTGCTGTGCTGG + Intronic
1072397934 10:95064367-95064389 TGGATCTCAGACTGCTGTGCTGG + Intronic
1072493704 10:95934253-95934275 TCGACTTCAGACTGCTGTGCTGG + Intronic
1072876178 10:99175388-99175410 TCGACTTCAGACTGCTGTGCTGG - Intronic
1072953587 10:99869860-99869882 TTGAATTGAGACTGCTGTGCTGG + Intergenic
1073698129 10:105893699-105893721 TCGACTTCAGACTGCTATGCTGG - Intergenic
1073884186 10:108019462-108019484 TGGACCTCAGACTGCTGTGCTGG - Intergenic
1074616910 10:115078849-115078871 TCGATCTCAGACTGCTGTGCTGG + Intergenic
1074648517 10:115491620-115491642 TCAACCTCAGACTGCTGTGCTGG + Intronic
1074795509 10:116939039-116939061 TTGACCTCAGACTGCTGTGCTGG + Intronic
1074985174 10:118652148-118652170 TCGACTTCAGACTGCTGTTCTGG + Intergenic
1075862058 10:125685353-125685375 TAGACTCCAGACTGCAGAACAGG - Intergenic
1075983924 10:126766919-126766941 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1076389796 10:130090680-130090702 TTGACTTCATACTGCTGTGCTGG - Intergenic
1076568629 10:131416185-131416207 TTGAGCTCAGAGTGTTGTACCGG - Intergenic
1076772857 10:132676599-132676621 TGGCCTACAGACTGCTGTCCCGG + Intronic
1077428312 11:2498558-2498580 TCAACTTCAGACTGCTGTGCTGG + Intronic
1077562053 11:3270294-3270316 CAGACTTCAGACTGCTGTGCTGG + Intergenic
1077567947 11:3316114-3316136 CAGACTTCAGACTGCTGTGCTGG + Intergenic
1077888974 11:6405285-6405307 TTGGGTTCAAACTGCTGTGCAGG - Intronic
1078331489 11:10425962-10425984 TAGACTTCAGACTGCTGTGCTGG + Intronic
1078392906 11:10952137-10952159 TCAACATCAGACTGCTGTGCTGG + Intergenic
1078686193 11:13534545-13534567 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1078743429 11:14090020-14090042 TCAACTTCAGACTGCTGTGCTGG + Intronic
1078809429 11:14743434-14743456 TTGACTTCAGACTGCTGTGCTGG + Intronic
1079185933 11:18236539-18236561 TTGACTTTAGTCTGCTGTATTGG - Intronic
1079264869 11:18921351-18921373 TCGACTTCAGACTGCTGCGCCGG - Intergenic
1079267044 11:18943498-18943520 TCGACTTCAGACTGCTGCGCCGG - Intergenic
1079510581 11:21205493-21205515 TGGACTTCAGACCGCCGTGCTGG + Intronic
1079517866 11:21289759-21289781 TTGACTTCAGACTGCTGTGCTGG - Intronic
1079714900 11:23732164-23732186 TGGACTTCAGACTGCTGTGCTGG - Intergenic
1079799783 11:24854492-24854514 TTGTCTTCAGACTGTTGTGCTGG + Intronic
1079867905 11:25758559-25758581 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1080033613 11:27688282-27688304 TTGACTTCAGGCAGCTGTGCTGG + Intronic
1080334535 11:31180981-31181003 TCGACTTCAGCCTGCTGTGCTGG - Intronic
1080710055 11:34738100-34738122 TTGACCTCAGACTGCTGCGCTGG - Intergenic
1080965629 11:37210987-37211009 TCAACTTTAGACTGCTGTGCTGG + Intergenic
1080977150 11:37356838-37356860 TTGACTTCAGATTGTTGTGCTGG - Intergenic
1081094963 11:38921190-38921212 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1081198792 11:40192719-40192741 TCAACTTCAGACTGCTGTGCTGG - Intronic
1081221590 11:40469648-40469670 TAGACTTCAGACTGCTGTCCTGG - Intronic
1081252357 11:40851001-40851023 TGGACTTCACACTGCTGTGCTGG + Intronic
1081363290 11:42205615-42205637 TTGACTTCAGACTGCTGTGATGG - Intergenic
1082867084 11:57910292-57910314 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1082872145 11:57953407-57953429 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1082876330 11:57992567-57992589 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1082903601 11:58283160-58283182 TTGACTTTAGACTGCAGTGCTGG + Intergenic
1082924382 11:58530315-58530337 TCGAGCTCAGACTGCTGTGCTGG - Intronic
1082968160 11:58989685-58989707 TTGATCTCAGACTACTGCACTGG + Intronic
1083498308 11:63078700-63078722 TTGATCTCAGACTGCTGTGCTGG + Intergenic
1083507033 11:63167433-63167455 TCGACCTCAGACTGATGTGCTGG - Intronic
1083510218 11:63202419-63202441 TCGACTTCAGCCTGCTGTGCTGG - Intronic
1083516222 11:63261691-63261713 TCGACTTCAGACTGCTGTGCTGG + Intronic
1085433852 11:76481512-76481534 TTAACTTCAGACTGCTGTGCTGG - Intronic
1085683801 11:78603308-78603330 TCGACTTCAGACTGCTGGGCTGG + Intergenic
1085850067 11:80109614-80109636 TCAACTCCAGACTGCTGTGCTGG - Intergenic
1086106080 11:83148775-83148797 TTGACTTCAGACTGCTGATTAGG - Intergenic
1086129195 11:83383236-83383258 TTGGCTTCAGACTGCTGTGCTGG - Intergenic
1086300342 11:85420809-85420831 TTGACTTCAGACTGCTCTGCTGG + Intronic
1086348867 11:85924877-85924899 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1086410709 11:86541413-86541435 TCAACTTCAGACTGCTGTGCTGG - Intronic
1086421908 11:86645329-86645351 TTGACTTCAGACTGCTGTGCTGG - Intronic
1086437327 11:86795034-86795056 TTGTCTTCAGTCTGGTCTACAGG - Intronic
1086505296 11:87497961-87497983 TCAACTTCAGACTGTTGTGCTGG - Intergenic
1086532370 11:87801058-87801080 TCAGCTTCAGACTGCTGTTCTGG + Intergenic
1086608443 11:88725151-88725173 TCAACTTCAGACTGCTGTGCTGG - Intronic
1086735663 11:90302512-90302534 TTGAGCTCAGACTGCTGTGCTGG + Intergenic
1086757578 11:90583200-90583222 TTGATCTCAGACTGCTGTGCTGG + Intergenic
1086924023 11:92620751-92620773 CTTAATTCAGACTGCTGTAACGG + Intronic
1087402717 11:97687904-97687926 TTGTCTTCAGACTCCTGTCTAGG + Intergenic
1087427770 11:98012653-98012675 TCGACTTCAGAGTGCTGTGCTGG - Intergenic
1087667783 11:101070591-101070613 TCGACTTCACACTGCTGTGCTGG - Intronic
1087695300 11:101369680-101369702 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1087830981 11:102819763-102819785 TCGACTTCGGACTACTGTGCTGG + Intergenic
1088078309 11:105878764-105878786 TTGACCTCAGACTGCTGTGCTGG + Intronic
1088211937 11:107466328-107466350 TCGACTTCAGACTGCTGGGCTGG + Intergenic
1088294478 11:108277239-108277261 TCGACTTCAGACTGTTCTGCTGG + Intronic
1088307263 11:108423349-108423371 TCGATTTCAGACTGTTGTGCTGG - Intronic
1088491060 11:110388501-110388523 TTGATCTCAGACTGGTGTGCTGG + Intergenic
1088702542 11:112426324-112426346 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1089101639 11:115967321-115967343 TTGATCTCAGACTGCTGTGCTGG - Intergenic
1089766033 11:120766326-120766348 TCGACTTCAGACTGCTGTGCTGG + Intronic
1090160745 11:124492195-124492217 TTGACTTCAGCCTGCTACTCAGG - Intergenic
1090201616 11:124861740-124861762 TTGTCTTCAGACTGCACTCCTGG + Intergenic
1090307483 11:125703708-125703730 TTGACTTCAGACTGCTGTAATGG - Intergenic
1090318410 11:125818209-125818231 TCAACTTCAGACTGGTGTGCTGG - Intergenic
1090564122 11:127968175-127968197 GTGACTTCAGTCTTTTGTACAGG + Intergenic
1090688866 11:129156358-129156380 TCGACTTCAGACTGCTGTGCTGG - Intronic
1090720407 11:129467315-129467337 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1090725105 11:129517975-129517997 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1090811684 11:130250033-130250055 TCAACTTCAGACTGCTGTGCTGG - Intronic
1090896113 11:130976962-130976984 TCCACTTCAGACTGCTGTGCTGG + Intergenic
1091090033 11:132762687-132762709 TCAACTTCAGACTACTGTGCTGG + Intronic
1091213525 11:133885114-133885136 TCAACTTCAGACTGCTGTACTGG + Intergenic
1091712152 12:2749704-2749726 TCGACTTCAGACTGCTGTTCTGG - Intergenic
1091712236 12:2750211-2750233 TCGACTTCAGACTGCTGTTCTGG + Intergenic
1092304363 12:7283820-7283842 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1092398793 12:8153759-8153781 TCAACTTCAGACTGCTGTGCTGG + Intronic
1092440394 12:8496176-8496198 TCGACTTCAGGCTGCTGTGCTGG - Intergenic
1092567700 12:9685728-9685750 TCCACTTCAGACTGCTGTGCTGG + Intronic
1092628956 12:10358398-10358420 TCCACTTCAGACTGCTGCGCTGG + Intergenic
1092637411 12:10466775-10466797 TTGATTTCAGAATGCTCTGCTGG + Intergenic
1092638886 12:10481939-10481961 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1092703245 12:11256612-11256634 TGGACTTCAGACTGCTGTGCTGG - Intergenic
1093004416 12:14036043-14036065 TCAACTTCGGACTGCTGTGCTGG - Intergenic
1093333205 12:17868669-17868691 TAGACTTCAAACGGCTGTGCTGG - Intergenic
1093336049 12:17905926-17905948 TCGACTACAGACTGCTGTGCTGG + Intergenic
1093545053 12:20336484-20336506 TGGATTTCAGACTGCTGTGCTGG + Intergenic
1093610524 12:21149968-21149990 TTGACTTCAGACTGCTCGGCTGG - Intronic
1093664471 12:21795423-21795445 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1093694752 12:22146749-22146771 TTGACTTTAGACTGCTGTGCTGG - Intronic
1094061086 12:26316180-26316202 CTGACTTCAGACTGCTGTGCTGG + Intergenic
1094140034 12:27171748-27171770 TTGACCTCAGACTGCTATGCTGG + Intergenic
1094733120 12:33200741-33200763 TCGACTTCAGATTGCTGTGCTGG + Intergenic
1094757854 12:33492836-33492858 TCAACTTCAGACTGTTGTGCTGG - Intergenic
1094782066 12:33802705-33802727 TTGACTTCAGACTGCTGTGTTGG + Intergenic
1095119942 12:38405235-38405257 TTGACTTTAGACTGCTGGATTGG + Intergenic
1095140549 12:38657275-38657297 TCGATCTCAGACTGCTGCACTGG - Intronic
1095247871 12:39943628-39943650 TCGATTTCAGACTGCTGTGCTGG + Intronic
1095356422 12:41280480-41280502 TTGACTTCAGACTGCTGTGCTGG - Intronic
1095406335 12:41870797-41870819 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1095488485 12:42708459-42708481 TCAACTTCAGACTGCTATGCTGG - Intergenic
1095547365 12:43387903-43387925 TTGACATCAGACTGCCGTGCTGG + Intronic
1095646993 12:44558941-44558963 TAGACTTCAGACTGCTGTGCTGG - Intronic
1095674236 12:44897883-44897905 TTGGCTTCAGACTGCTGGGCTGG - Intronic
1095804691 12:46305610-46305632 TAGACTTCAGCAGGCTGTACAGG - Intergenic
1095831475 12:46591534-46591556 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1095917820 12:47497833-47497855 TTGACTTCAGACTGCTGTACTGG - Intergenic
1095920634 12:47526461-47526483 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1095930926 12:47624411-47624433 TCGACTTCAGACTGCCGTGCTGG - Intergenic
1096790071 12:54039059-54039081 GTGAATTCAGGCTCCTGTACTGG + Intronic
1096941844 12:55355495-55355517 TCGACCTCAGACTGCTGTACTGG - Intergenic
1096955206 12:55518715-55518737 TTGATCTCAGACTGCTGTGCTGG - Intergenic
1097268559 12:57760048-57760070 TTCACTTCACACTGCTTTTCTGG - Exonic
1097412123 12:59268173-59268195 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1097619507 12:61922863-61922885 TTGACTTCAGATTGCTGTGTTGG - Intronic
1097635197 12:62113865-62113887 TCGACTTCAGACTGCTGTACTGG + Intronic
1097737381 12:63196788-63196810 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1097898803 12:64853363-64853385 TTGACTTCAGACTGCTGTGCTGG + Intronic
1097948811 12:65403479-65403501 TCAACTTCGGACTGCTGTGCTGG + Intronic
1098151872 12:67555583-67555605 TTGACCTCAGACTGCTGTGCTGG + Intergenic
1098438786 12:70497078-70497100 TTGCCTTCTGACTGCTGTGCTGG + Intergenic
1098635623 12:72780467-72780489 CCGACTTCAGGCTGCTGTGCTGG - Intergenic
1098706880 12:73702572-73702594 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1098780163 12:74676652-74676674 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1098906655 12:76169720-76169742 TCGACTTCAGACTGCTGTACTGG + Intergenic
1099053468 12:77809045-77809067 TCGACTTCAGAATGCTGTGCTGG + Intergenic
1099071374 12:78049092-78049114 TGTCCTTCAGACTGCTGTGCTGG + Intronic
1099236108 12:80084148-80084170 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1099238933 12:80115924-80115946 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1099253719 12:80289769-80289791 TTAACTTCAGACTGCTGTGCTGG + Intronic
1099486253 12:83232684-83232706 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1099492037 12:83300015-83300037 TCGACCTCAGACTACTGTGCTGG - Intergenic
1099522507 12:83681805-83681827 TCAACCTCAGACTGCTGTGCTGG - Intergenic
1099551039 12:84043630-84043652 TTGACTTCAGTCTGTTGTGCTGG + Intergenic
1099699117 12:86061640-86061662 TTGACCTCAGACCGCTGTGCTGG - Intronic
1099744983 12:86690188-86690210 TCGACTTCAGACTGCTGTGCTGG + Intronic
1099798015 12:87422531-87422553 TCAACTTCAGACTGTTGTGCTGG + Intergenic
1099897546 12:88667722-88667744 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1099943960 12:89222873-89222895 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1100008298 12:89921246-89921268 TTGACTACAGACTGATCTAGTGG - Intergenic
1100111047 12:91242824-91242846 TTGACTTCAGACTGCTCTCCTGG - Intergenic
1100136272 12:91557048-91557070 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1100675210 12:96858992-96859014 TTGACTTCAAACTACACTACGGG + Intronic
1100740044 12:97581658-97581680 TCAACTTCAGACTGCTGTGTCGG - Intergenic
1100768740 12:97898180-97898202 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1100797994 12:98202252-98202274 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1100896267 12:99186008-99186030 TTGACTTCAGACTGCTGTGCTGG - Intronic
1100996263 12:100304130-100304152 TTGATTTCAGACTGCTGTGCTGG + Intronic
1101069868 12:101062758-101062780 TCAACTTCAGACTGCTATGCTGG + Intronic
1101296082 12:103424953-103424975 TCAACTTCAGACTGCTGTGCTGG - Intronic
1101472669 12:105013353-105013375 TTGACTTCAGACTGCTGTGCTGG + Intronic
1102345579 12:112159064-112159086 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1103255655 12:119539556-119539578 TCGACTTCAGACTGCTGTGCTGG + Intronic
1104115604 12:125746419-125746441 CTGACTTCAGACTGCTGTGCTGG + Intergenic
1105316462 13:19270074-19270096 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1105355104 13:19652698-19652720 TTGATCTCAGACTGCTGTGCTGG - Intronic
1105552482 13:21410734-21410756 TCAACTTCAGACTGCTGTGCTGG + Intronic
1105645795 13:22316321-22316343 TCGACTTCAGCCTGCTGTGCTGG + Intergenic
1105769401 13:23594370-23594392 TGGACTTCACACTGCTGTGCTGG - Intronic
1106042140 13:26103529-26103551 TCGATTTCAGACTGCTGTACTGG - Intergenic
1106335081 13:28776757-28776779 TCAACTTCAGAGTGCTGTGCTGG + Intergenic
1106336586 13:28789059-28789081 TTGACTTCAGACTACTGTTCTGG + Intergenic
1106377442 13:29203385-29203407 TTGACTTCAGACTGCTGTGCTGG + Intronic
1106391166 13:29337016-29337038 TTGACTTCAGAGTGCTGTGCTGG + Intronic
1106426590 13:29636532-29636554 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1106429420 13:29665840-29665862 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1106563477 13:30866127-30866149 TTGACTTCAAAGTGCTGTAAGGG + Intergenic
1106612311 13:31295688-31295710 GGGACTTCAGACTGCTGTGCTGG + Intronic
1106650860 13:31688512-31688534 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1106874239 13:34054643-34054665 TCGACTTCAGACTGCTGTGGTGG + Intergenic
1106983867 13:35321970-35321992 TTGACTTCAGACTGCTGTGCTGG + Intronic
1107289829 13:38839829-38839851 TTGACTTCAGTCTGCTGTGCTGG + Intronic
1107473470 13:40712741-40712763 TCAACTTCGGACTGCTGTGCTGG + Intergenic
1107648167 13:42516549-42516571 TCGACCTCAGACTGCTGTGCTGG - Intergenic
1107674085 13:42776825-42776847 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1107856462 13:44620098-44620120 TGGCCTTTAGACTGCTGTTCTGG + Intergenic
1107968849 13:45622255-45622277 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1108030085 13:46220477-46220499 TCGACTTCAGACTGCTGTGCTGG + Intronic
1108048810 13:46408966-46408988 TCGACTTCAGACTGCTGTAATGG + Intronic
1108235044 13:48394519-48394541 TCGACCTCAGACTGCTGTGATGG - Intronic
1108236831 13:48416702-48416724 TCGACTTCAGACTCCTGTGCTGG - Intronic
1108304597 13:49118622-49118644 TGGACTTCAGACTGCTGTGCTGG - Intronic
1108383799 13:49879642-49879664 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1108599859 13:51983181-51983203 TCGATTTCAGACTGTTGTGCTGG - Intronic
1108674046 13:52721173-52721195 TCGACTTCAAACTGCTGTGCTGG + Intronic
1108858231 13:54822071-54822093 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1108998308 13:56763410-56763432 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1109033847 13:57230211-57230233 TTGGCTTCAGACTGCGGTGCTGG - Intergenic
1109187896 13:59291965-59291987 TTGACTTCAGATTTCTGTGCTGG - Intergenic
1109195925 13:59377393-59377415 TGAACTTCAGACTGCTGTGCTGG - Intergenic
1109271291 13:60258540-60258562 TTGACCCCAGACTGCTGTGCTGG - Intergenic
1109328650 13:60900603-60900625 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1109366595 13:61364481-61364503 TCGATTTCAGACTGCTGTGCTGG - Intergenic
1109457499 13:62611593-62611615 TAGACTTCAGACTGCTGTGCTGG + Intergenic
1109541340 13:63782311-63782333 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1109615417 13:64828282-64828304 TCGATCTCAGACTGCTGTGCTGG - Intergenic
1109626635 13:64982893-64982915 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1109661635 13:65467474-65467496 TCAACTTAAGACTGCTGTGCTGG + Intergenic
1109731548 13:66419939-66419961 TAGACTTCAGACTGCTGTGCTGG - Intronic
1109891162 13:68616889-68616911 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1109902803 13:68795750-68795772 TGGACTTCAGACTGCTGTGCTGG + Intergenic
1110019950 13:70457571-70457593 TTGACTTCAGATTCCTATGCTGG - Intergenic
1110135520 13:72062688-72062710 TCGACCTCAGACTGCTGTGCTGG - Intergenic
1110337276 13:74346851-74346873 TGGACTCCAGACTGCTGTGCTGG - Intergenic
1110824681 13:79958388-79958410 TTAACTTCAGACTGCTGTGCTGG - Intergenic
1110890281 13:80689860-80689882 TCAACTTTAGACTGCTGTGCTGG - Intergenic
1111017666 13:82402594-82402616 TTGACTTCAGACTGCTTTGCTGG - Intergenic
1111056078 13:82952867-82952889 TTGACTCCAGACTGCTGTGCTGG - Intergenic
1111273545 13:85917523-85917545 TTGATCTCAGACTCCTGTGCTGG + Intergenic
1111627944 13:90813460-90813482 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1111635073 13:90892952-90892974 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1112151919 13:96773443-96773465 TCGACTTCAGAATGCTGTGCTGG - Intronic
1112165841 13:96918983-96919005 TGGACTTCAGACTGCTATGCTGG - Intergenic
1112231606 13:97593487-97593509 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1112546511 13:100376678-100376700 TTGACTTCAGACTGCTGTGCTGG + Intronic
1112620157 13:101046802-101046824 TTGACTTCATACTGCTGTGCTGG + Intergenic
1113131521 13:107042491-107042513 TCAACTGCAGACTGCTGTGCTGG + Intergenic
1114133564 14:19820803-19820825 TGAACTTCAGAGTGCTGTGCTGG + Intronic
1114695486 14:24623588-24623610 TGGATTTCAGACTGCTGTGCTGG + Intergenic
1114710063 14:24768720-24768742 TCAACTTCACACTGCTGTGCTGG - Intergenic
1114817662 14:25979427-25979449 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1114844889 14:26309180-26309202 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1114870117 14:26645670-26645692 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1114992406 14:28302629-28302651 TTGACTTCAAACTACTCTAAAGG + Intergenic
1115043101 14:28955547-28955569 TTTACTTCAGACTGCTGTGCTGG - Intergenic
1115048705 14:29029250-29029272 TCAACTTCAGACTGTTGTGCTGG + Intergenic
1115124187 14:29972598-29972620 TTGACTTCAGACTGCTGAGCTGG - Intronic
1115265366 14:31494678-31494700 TCAACTTCAGACTGCTGTGCTGG - Intronic
1115277070 14:31621156-31621178 TTGACCTCAGACTGCTGTGCTGG + Intronic
1115281508 14:31668433-31668455 TTGACTTCAGACTGCCGTGCTGG + Intronic
1115335399 14:32240345-32240367 TTGATCTCAGACTGCTGTGCTGG + Intergenic
1115357161 14:32460836-32460858 CTGACCTCAGACTGCTGTGCTGG - Intronic
1115359819 14:32488404-32488426 TGGATTTCAGACTGCTGTGCTGG + Intronic
1115511273 14:34139906-34139928 TCCACTTCACACTGCTGTGCTGG - Intronic
1115681827 14:35747945-35747967 TTGACTTCAGAATGCCTTAGAGG + Intronic
1115691032 14:35844060-35844082 TCAACTTCAGACTGCTGTGCTGG + Intronic
1115721097 14:36162082-36162104 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1115827467 14:37293711-37293733 TTGATCTCAGACTACTGTGCTGG - Intronic
1115842746 14:37490325-37490347 TCGACCTCATACTCCTGTACTGG + Intronic
1115856268 14:37632996-37633018 TTGACTTCAGACTGCTGTGCTGG + Intronic
1115867236 14:37760888-37760910 TCGACTTCAGACTGTTGCCCTGG + Intronic
1115912163 14:38268829-38268851 TTGACTTCAGACTTCTGTGCTGG + Intergenic
1115940339 14:38601690-38601712 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1115943580 14:38635333-38635355 TTGATCTCAGACTGCTGTGCTGG - Intergenic
1115974409 14:38981064-38981086 CCAACTTCAGACTGCTGTGCTGG + Intergenic
1116227512 14:42171169-42171191 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1116511889 14:45756470-45756492 TTGACTTCAGATGGCTATGCTGG + Intergenic
1116546077 14:46166873-46166895 TTGATCTCAGACTGCTGTGCTGG + Intergenic
1116565400 14:46438753-46438775 TCAACTTCAAACTGCTGTGCTGG - Intergenic
1116771483 14:49131661-49131683 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1116775718 14:49178743-49178765 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1116781770 14:49244396-49244418 TCGACTCCAGACTGCTGTGCCGG - Intergenic
1117104264 14:52382420-52382442 TTGACTTCAGACTGCTGTTCTGG - Intergenic
1117116109 14:52514336-52514358 TTGACTTCAAAATGCTCTTCAGG - Intronic
1117237969 14:53798480-53798502 TTGACTTCAGACTGCTATGCTGG - Intergenic
1117299261 14:54407720-54407742 TTGACTTCAGACTGCTGTGCTGG + Intronic
1117599996 14:57365175-57365197 TAGACTTCAGACTGCTGTACTGG - Intergenic
1117624224 14:57618807-57618829 TCCACCTCAGACTGCTGTGCTGG - Intronic
1117710692 14:58525828-58525850 TCGACTTCAGACTGCTGTGCTGG - Intronic
1117850076 14:59958498-59958520 TCGACTTCAGACTGCTGTGCTGG + Intronic
1117856777 14:60042488-60042510 TCGATCTCAGACTGCTGTGCTGG + Intronic
1117859366 14:60073751-60073773 TTGACTTCAGATTGCTGTGCTGG - Intergenic
1117930543 14:60837095-60837117 TCGACTTCAGACTGTTGTGCTGG + Intronic
1117932195 14:60855186-60855208 TTGACTTCACACTGCTGTGCTGG + Intronic
1118516094 14:66530320-66530342 TCAACTTCAGACTGCTGTGCTGG + Intronic
1118544710 14:66873529-66873551 TCGACTTCAGACTGCTGTGCTGG - Intronic
1118888918 14:69890708-69890730 TTGAGCTCAGACTGCTTTAAAGG + Intronic
1119018486 14:71084720-71084742 TCAACTTCAGACTGCTGTGCTGG + Intronic
1120137274 14:80884925-80884947 TCGACTTCAGACTGCTATGCTGG - Intronic
1120201327 14:81540944-81540966 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1120271782 14:82321963-82321985 TAGACTTCAGACTGCTGTGCTGG + Intergenic
1120450043 14:84655443-84655465 TTGACTTCAGAATGCTGTGCTGG + Intergenic
1120565333 14:86048210-86048232 TGGACTTCAAACTGATGTTCTGG + Intergenic
1120770113 14:88370136-88370158 TCGACTTTAGACTGCTGTGCTGG - Intergenic
1120773851 14:88411244-88411266 TCAACTTCAGACTGCTGTGCTGG + Intronic
1120824190 14:88940501-88940523 TTGGCTTCACACTGATGGACTGG - Intergenic
1120843164 14:89104697-89104719 TCAACTTCAGACTGCTGTGCAGG + Intergenic
1121898985 14:97674888-97674910 TCGACTTCAGACAGCTGTGCTGG - Intergenic
1123166630 14:106331276-106331298 TTGCCTGCAGACTGGTGAACTGG + Intergenic
1123480824 15:20629356-20629378 TCAACTTCAGACTGCTGTCCGGG - Intergenic
1123576632 15:21676372-21676394 TCAACTTCAGAGTGCTGTGCTGG + Intergenic
1123613254 15:22118840-22118862 TCAACTTCAGAGTGCTGTGCTGG + Intergenic
1123637188 15:22371009-22371031 TCAACTTCAGACTGCTGTCCGGG + Intergenic
1124474679 15:30022760-30022782 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1125013011 15:34900576-34900598 TTGACTACAGAATGCTGGAGAGG + Intronic
1125219553 15:37317639-37317661 TGGACCTCAGACTGCTGTGCTGG - Intergenic
1125330007 15:38573441-38573463 TTGACTTCAGACTGCTGGGCTGG + Intergenic
1125784290 15:42301620-42301642 TCAACTTCAGACTGCTGTGGTGG - Intronic
1126050826 15:44683356-44683378 TTGACTTCAGACTGCTGTGCTGG - Intronic
1126500551 15:49339991-49340013 TTGAGCTCAGACTGCTGTGCTGG + Intronic
1126554079 15:49966387-49966409 TCAACTTCAGACTGCTGTGCTGG - Intronic
1126871886 15:52998219-52998241 TTGACTTCAAACTACACTACCGG + Intergenic
1126932390 15:53669129-53669151 TGTACTACAGACAGCTGTACTGG - Intronic
1127030018 15:54851301-54851323 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1127056282 15:55135475-55135497 TCGACTTCAGACTGCTGTGTTGG - Intergenic
1127317877 15:57814969-57814991 TCGACCTCAGACTGCTGTGCTGG + Intergenic
1127373725 15:58363167-58363189 TTGACTTCAGACAGCCGTGCTGG - Intronic
1128988529 15:72239183-72239205 CTGACTCCAGATTGCTGTTCTGG - Intergenic
1129495592 15:75977195-75977217 TCGACTTCAGACTGCTGTGCTGG + Intronic
1129499155 15:76019205-76019227 TCGACTTCAGACTGCTGTGCTGG + Intronic
1129563200 15:76593088-76593110 TCGACTTCAGACTGCTGTGCTGG - Intronic
1130441916 15:83963274-83963296 TCAACTTCGCACTGCTGTACTGG - Intronic
1130724022 15:86419730-86419752 TCGACTTCAGACTGCTGTGCTGG - Intronic
1130728678 15:86467346-86467368 TCGACTTCAGACTGCTGTGCTGG + Intronic
1130729328 15:86474478-86474500 TCGATCTCAGACTGCTGTGCTGG - Intronic
1202985500 15_KI270727v1_random:410617-410639 TCAACTTCAGAGTGCTGTGCTGG + Intergenic
1133178327 16:4033074-4033096 TAGACTTCAGACTGATGTCCTGG + Intronic
1133956993 16:10452957-10452979 TCAACCTCAGACTGCTGTGCTGG + Intronic
1134767623 16:16774615-16774637 TTGAGCTCAGACTGCTGTGCTGG + Intergenic
1135807548 16:25556407-25556429 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1137296315 16:47097289-47097311 TCAACTTCAGACTGCTGTGCTGG - Intronic
1137304272 16:47183153-47183175 TTGATCTCAGACTGCTGTGCTGG - Intronic
1137336482 16:47554390-47554412 TCAACTTCAGACTGCTGTGCTGG + Intronic
1137828094 16:51517042-51517064 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1137969994 16:52975441-52975463 TCGACTTCAAACTGATGTGCTGG + Intergenic
1138702499 16:58878863-58878885 TAGATCTCAGACTGCTGTGCTGG + Intergenic
1138706457 16:58920515-58920537 TCAACTTCAGACTGCTCTCCTGG + Intergenic
1138799757 16:60013239-60013261 CCGACTCCAGACTGCTGTGCTGG - Intergenic
1138843659 16:60539147-60539169 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1138886910 16:61091036-61091058 TCGATTTCAGACTGCTGTGTTGG - Intergenic
1139718030 16:68829658-68829680 TTGACTTGAGCCAGCTGCACAGG + Exonic
1141246119 16:82309286-82309308 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1142022836 16:87794894-87794916 TTGGCTTCAGACCGCTGATCAGG - Intergenic
1143427145 17:6849066-6849088 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1144012534 17:11163477-11163499 ATGACTTTAGACTGCTTTGCTGG - Intergenic
1144371768 17:14598033-14598055 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1144434124 17:15223975-15223997 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1146446802 17:32938591-32938613 TTGGCTTCACACTGCTCTACTGG - Intronic
1146742830 17:35301416-35301438 TCAACTTTAGACTGCTGTGCTGG - Intergenic
1146817419 17:35953961-35953983 TCGACTTCTGACTGCTGTGCTGG + Intergenic
1146825942 17:36023411-36023433 TAGACTTCAGACTGCTGTGCTGG + Intergenic
1146835718 17:36108920-36108942 GTGAATGCAGACTGCAGTACAGG - Intergenic
1146850348 17:36216189-36216211 GTGAATGCAGACTGCAGTACAGG - Intronic
1148403249 17:47386507-47386529 TTGACTTCAGACTGCTGTGCTGG + Intronic
1148967378 17:51447239-51447261 TCAACTCCAGACTGCTGTGCTGG - Intergenic
1148981028 17:51574974-51574996 TAGAGTTCAGACTGCTGTGCTGG - Intergenic
1149196980 17:54132926-54132948 TCGATCTCAGACTGCTGTGCAGG + Intergenic
1149222879 17:54436115-54436137 TTGACCTCAGACTGATGTGCTGG - Intergenic
1149281281 17:55108281-55108303 TCAACTTCAGACTGCTGGGCTGG + Intronic
1149365452 17:55939246-55939268 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1149942669 17:60887063-60887085 TTGATCTCAGACTGCTGTGCTGG + Intronic
1150090758 17:62322876-62322898 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1150545773 17:66155663-66155685 TCGACTTCAGACTGCTGTGCTGG - Intronic
1150884621 17:69070857-69070879 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1151064191 17:71131867-71131889 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1151421709 17:74002575-74002597 ATGACTTAAGACTTCTGTACTGG + Intergenic
1153313418 18:3699997-3700019 TGGACTTCAGGCTGCTGTTCTGG + Intronic
1153702608 18:7711599-7711621 TCAACTTCAGACTGCTCTCCTGG - Intronic
1153717858 18:7869070-7869092 TTGACTTCAGACTGCTGTGCTGG + Intronic
1153726997 18:7966829-7966851 TTGATCTCAGACTGCTGTGCTGG - Intronic
1153735533 18:8063076-8063098 TTGATCTCAGACTGCTGTGCTGG + Intronic
1153798456 18:8646992-8647014 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1154101553 18:11479305-11479327 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1155114219 18:22748900-22748922 TCAACCTCAGACTGCTGTGCTGG - Intergenic
1155395318 18:25380353-25380375 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1155764770 18:29614678-29614700 TTGACTTCAAACTATTCTACAGG + Intergenic
1155857345 18:30850146-30850168 TTGACTTCAGACTGCTCTGCTGG + Intergenic
1156295937 18:35790999-35791021 TCGATCTCAGACTGCTGTGCTGG - Intergenic
1156415141 18:36879903-36879925 TTGACTTCAGAGTGCTGTGCTGG + Intronic
1157067306 18:44366824-44366846 TCGACTTCAGACTGCTGTGTTGG + Intergenic
1157068088 18:44375087-44375109 CCAACTTCAGACTGCTGTGCTGG - Intergenic
1157178875 18:45477857-45477879 CTGACTTCAGACTGCTGTGCTGG + Intronic
1158128756 18:54129662-54129684 TTCACCTCAGAATGCTGCACCGG + Intergenic
1158373167 18:56832107-56832129 TCAACCTCAGACTGCTGTGCTGG - Intronic
1158659351 18:59371991-59372013 TTGTCTTCAGACTGCTGTGCTGG + Intergenic
1159254716 18:65931202-65931224 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1159385973 18:67725908-67725930 TCGACTTCAGACTGCTGTGATGG + Intergenic
1159562189 18:70007524-70007546 TCGACTTCAGACTGCTGTGCAGG - Intronic
1159581321 18:70236984-70237006 TCGACTTCAGACGGCTGTGCTGG - Intergenic
1159645802 18:70916630-70916652 TTGACCTCAGACTGCTGTGCTGG + Intergenic
1159690600 18:71482882-71482904 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1159901762 18:74053519-74053541 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1160466660 18:79083279-79083301 TTGACTTCAGACTGCTGTGCTGG + Intronic
1161880804 19:6950614-6950636 TTGAATTCAGACTCCTCTATTGG - Intergenic
1163674670 19:18649609-18649631 TCCACTTCAGACAGCTGGACAGG - Intronic
1164152379 19:22566194-22566216 TGGACCTCAGACTGCTGTGCTGG + Intergenic
1165254598 19:34568089-34568111 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1166263183 19:41657303-41657325 TAGACTTCAGACTGCTGTGCTGG - Intronic
1166433791 19:42749690-42749712 TTGATCTCAGACTGCTGTGCTGG + Intronic
1166436876 19:42774705-42774727 TTGATCTCAGACTGCTGTGCTGG + Intronic
1167872923 19:52388583-52388605 TGAACTTTTGACTGCTGTACTGG + Intergenic
1167974118 19:53210176-53210198 TCGACCTCAGACTGCTGTGCTGG + Intergenic
1168457693 19:56526620-56526642 TTGACTTCAGACTGCTGTGCTGG - Exonic
1168530862 19:57127651-57127673 TCAACTTCAGACTGCTGCACTGG + Intronic
925252457 2:2451566-2451588 TGGACTTCAGACTGCTGTGCTGG + Intergenic
925484515 2:4313217-4313239 TCGACTTTAGACTGCTGTGCTGG + Intergenic
925512506 2:4643355-4643377 TTGATCTCAGACTGCTGTGCTGG - Intergenic
925692342 2:6537937-6537959 TTGTCTTCAGACTGCTGTGCTGG - Intergenic
925729162 2:6905029-6905051 TTGACTTCAGACTGCTGTGCTGG + Intergenic
926483461 2:13427679-13427701 TGGACTTCAGACTGCTGTGCTGG + Intergenic
926533545 2:14082385-14082407 TCAACTTCAGACTGCTGCCCTGG - Intergenic
926943980 2:18168066-18168088 TCAACTTCAGACTGCTGTGCTGG + Intronic
927182789 2:20458872-20458894 TCAACTTCAGACTGCTGTGCTGG - Intergenic
928750642 2:34466778-34466800 TCGACTTCAGACTGCTGTGCTGG - Intergenic
928880167 2:36088651-36088673 TCAACTCCAGACTGCTGTGCTGG - Intergenic
929064751 2:37962564-37962586 TAGACTTCAGACTGCTGTGCTGG + Intronic
929256146 2:39813549-39813571 TCAAATTCAGACTGCTGTGCTGG + Intergenic
929257749 2:39830851-39830873 TCAACTTCAGACTGCTGTGCTGG + Intergenic
929333544 2:40712807-40712829 TCGACTTCAGACTGCTGTGCTGG + Intergenic
929838012 2:45426116-45426138 TTGACTTCAGACTGCTGTGCTGG - Intronic
930176056 2:48302815-48302837 TTGACTTCAGACTGCTGTTCTGG + Intergenic
930359321 2:50358347-50358369 TCGACTTCAGGCTGCTGTGCTGG - Intronic
930434132 2:51318463-51318485 TTGATCTCAGACTGCTGTGCTGG + Intergenic
930476657 2:51891259-51891281 TTGACTTCAGACTGCTGTGCTGG + Intergenic
930489079 2:52045143-52045165 TTGATCTCAGACTGCCGTGCTGG + Intergenic
930860353 2:56065421-56065443 TCAACTTCACACTGCTGTGCTGG + Intergenic
930925735 2:56816396-56816418 TTGACTTGAGACTGCTGTGCTGG - Intergenic
930951329 2:57146827-57146849 CAGACTCCAGACTGCTGTGCTGG - Intergenic
931004089 2:57828222-57828244 TCGACTTCAGACTGCTGTGCTGG - Intergenic
931030393 2:58168715-58168737 TCTACTTCAGACTGCTGTGCTGG - Intronic
931212095 2:60207205-60207227 TTGACTTCAGGCTGCTGTGCTGG + Intergenic
931538662 2:63304862-63304884 TGGACTTCAAACTGCTGTGCTGG - Intronic
931566437 2:63620289-63620311 TAGACTTCAGACTGCTGTGCTGG - Intronic
931814826 2:65890219-65890241 TCAACTTCCGACTGCTGTGCTGG - Intergenic
931886704 2:66625850-66625872 TCAACTTCAGACTGCTGTGCTGG + Intergenic
932051804 2:68405463-68405485 TCAACTTCAGACTGCTGTGCTGG - Intergenic
932646791 2:73511060-73511082 TCGACTTCAGGCTGCTCTGCTGG + Intronic
932899502 2:75681711-75681733 TTGGGCTCAGACTGCTGTGCTGG - Intronic
932913881 2:75834257-75834279 TTGACTTCAGACTGCTGTGCTGG - Intergenic
932938963 2:76139585-76139607 TCAACTTCAGACTACTGTGCTGG + Intergenic
933001544 2:76930646-76930668 TTGACTTCAGCATGCTGTAGTGG + Intronic
933220768 2:79685447-79685469 TTCACTTCAGACTGCCGTGTAGG - Intronic
933317875 2:80736967-80736989 TAGACTCCAGACTGCTGTACTGG - Intergenic
933324235 2:80815398-80815420 TAGACTCCAGAGTGCTGTGCTGG - Intergenic
933413209 2:81951078-81951100 TTGACTTCAGACTGCTGTGCTGG + Intergenic
933749381 2:85593317-85593339 TTGAGGGCAGCCTGCTGTACTGG + Exonic
934702730 2:96454968-96454990 TTGAGTTCAGACTGCTGGGCTGG - Intergenic
934949769 2:98568168-98568190 GTGACTTCAGATTGGAGTACAGG + Intronic
935325829 2:101935935-101935957 TCAACTTCAGACTGCTGTGCTGG - Intergenic
935691386 2:105735408-105735430 TTGTTTTCACACTGCTATACAGG + Intergenic
935852252 2:107235581-107235603 TTGACTCCTGACTGCTGTGCTGG - Intergenic
935961483 2:108429711-108429733 TTGACTTCAGACTGATGTACTGG - Intergenic
936604379 2:113934705-113934727 CAGATTTCAGACTGGTGTACAGG + Intronic
936640274 2:114304172-114304194 TTGACTTCAGACTGCTGTGCTGG + Intergenic
936769530 2:115894970-115894992 TCGACTTCAGACTGATGTGCTGG + Intergenic
936900107 2:117472776-117472798 TCAACTTCAGACTGCTGTGCTGG - Intergenic
936999978 2:118457156-118457178 TGGACTTCAGACTGCTGTGTTGG + Intergenic
937143127 2:119618853-119618875 TGGACTTCAGACTGCTGTGCTGG - Intronic
937188426 2:120068473-120068495 TCGGCTTCAGACTGCTGTGCTGG - Intronic
937465023 2:122125004-122125026 CTGACCTCAGACTGTTGTGCTGG + Intergenic
937562720 2:123245029-123245051 TTGACTTCACATTGCTGTGCTGG - Intergenic
937573516 2:123391941-123391963 TTGACCTCAGACTGCTGTGCTGG - Intergenic
937807277 2:126161039-126161061 TCGACTTCAGACTGCTGTGCTGG - Intergenic
937893295 2:126956865-126956887 TCGACTTCAGACTGCTGTGCTGG - Intergenic
938144734 2:128823955-128823977 TTGACTTCAGACTGCTGTGCTGG - Intergenic
938224280 2:129602469-129602491 TTGCCTCCAGACTGCTGTGCTGG + Intergenic
938952326 2:136266626-136266648 TCGACTTCAGACTGCTGTGCTGG + Intergenic
939033265 2:137101656-137101678 TCGACTTCAGACTGCTGTGCTGG - Intronic
939180380 2:138796205-138796227 TAGACTTCAGACTGCTGTGCTGG - Intergenic
939244047 2:139599825-139599847 GTGACTTCAGACTCCTGTTAAGG - Intergenic
939382047 2:141448289-141448311 TTGACTTCAGACTGCTGTGCTGG + Intronic
939470656 2:142615957-142615979 TCGACTCCAGACTGCTGTGTTGG - Intergenic
939640854 2:144638544-144638566 TCAACTTCAGACTGCTGTCCTGG + Intergenic
939652804 2:144785544-144785566 TCAACTTCAGACTGCTGTGCTGG - Intergenic
939687157 2:145213697-145213719 TTGACTTCAGACTGCTGTGCTGG + Intergenic
939840605 2:147182775-147182797 TTGGCTTCAGACTGCTGAACTGG - Intergenic
939937768 2:148313514-148313536 TTGACTTCAGACTGCTCTGCTGG + Intronic
939946919 2:148421698-148421720 TGGACCTCAGACTGCTGTGCTGG - Intronic
940114404 2:150192443-150192465 TTGACTTCAGACTGCTGTGCTGG - Intergenic
940124843 2:150311560-150311582 TCAACTTCAGACTGCTGTGCTGG - Intergenic
940370551 2:152896143-152896165 TCAACTTCAGACTGCTGTGCTGG - Intergenic
940408095 2:153328679-153328701 TCAACTTCAGACTGCTGTGCTGG + Intergenic
940594011 2:155766945-155766967 TCGATCTCAGACTGCTGTGCTGG + Intergenic
940602598 2:155880475-155880497 TTGACTTCAGACTTCTGTGCTGG - Intergenic
940757937 2:157704746-157704768 TTGACTTCAGACTGCTGTGTTGG - Intergenic
940821398 2:158359941-158359963 TCAACTTCAGACTGCTGTGCTGG - Intronic
940946494 2:159623961-159623983 TTGACTTCAGACTGCTGTGCTGG - Intergenic
940957742 2:159747595-159747617 TTGACTTTACACAGCAGTACTGG + Intronic
940999013 2:160181255-160181277 TCGACTTCAGACTGCTGTGCTGG - Intronic
941115015 2:161462274-161462296 TTGACTTTAGACTGCTGTGCTGG + Intronic
941119584 2:161513454-161513476 TCGACTTCAGACTGCTGTGCTGG - Intronic
941239391 2:163017496-163017518 TCGACTTCAGACTGCTGTGCTGG + Intergenic
941276580 2:163497954-163497976 TTGACTTCAGACTGCTGTGCTGG - Intergenic
941464799 2:165813308-165813330 TTGACTTGAGACAGCTGAAAAGG - Intergenic
941478044 2:165972025-165972047 TCAACTACAGACTGCTGTGCTGG - Intergenic
941518728 2:166511452-166511474 TCAACTTCAGACTGCTGTGCTGG + Intergenic
941571515 2:167175991-167176013 TCGACTTCAGAGTGCTGTGCTGG + Intronic
942010866 2:171761408-171761430 CTGAGTTCAGACTGCTGTGCTGG + Intergenic
942407217 2:175668589-175668611 TTGACTTCAGACTGCTGTGCTGG - Intergenic
942411032 2:175709385-175709407 TTGATTTCAGACTGCAGTGCTGG - Intergenic
942431303 2:175914174-175914196 TGGACTTCAGACTGCTGTGCTGG + Intergenic
942940387 2:181608516-181608538 TTAAATTCAGACTGAAGTACAGG - Intronic
943094881 2:183416871-183416893 TCGACTTCAGACTGCTGTGCTGG - Intergenic
943105704 2:183543811-183543833 TCGACTTCAGACTGCCGTGGTGG - Intergenic
943112353 2:183621829-183621851 TCGACTTCAGACTGCTATGCTGG + Intergenic
943129963 2:183842141-183842163 TTGACTTCAGACTGCTGTGCTGG - Intergenic
943147691 2:184066031-184066053 TCGACTTCAGACTGCTGTGCTGG + Intergenic
943350708 2:186793270-186793292 TAGACTTCAGACTGCTGTGCTGG - Intergenic
943352518 2:186812354-186812376 TCAACTTCAGACTGCTGTGCTGG - Intergenic
943512307 2:188840886-188840908 TTGACTTCAGACTGCTGTACTGG - Intergenic
943599148 2:189893107-189893129 TCGACTTCAGACTGCTGTGCTGG + Intronic
943660478 2:190554422-190554444 TCGAGCTCAGACTGCTGTGCTGG - Intergenic
943836817 2:192524740-192524762 TCCACTTCAGCCTGCTGTGCTGG - Intergenic
944267899 2:197748500-197748522 TCGACTTCAGACAGCTGTGCTGG - Intronic
944292032 2:198018497-198018519 TCAATTTCAGACTGCTGTGCTGG - Intronic
944347385 2:198685058-198685080 CTGACCTCAGACTACTGTGCTGG - Intergenic
944591263 2:201219896-201219918 TTGACTTCAGCCAGGTGAACTGG + Exonic
944607920 2:201369882-201369904 TCGATCTCAGACTGCTGTGCTGG - Intergenic
944635408 2:201671334-201671356 TCAACTTCAGACTGCTGTGCTGG - Intronic
944764349 2:202849399-202849421 TCAACTTCAGACTGCTGTGCTGG - Intronic
945207217 2:207344723-207344745 TTGACTTCAGACTGCTGTGCTGG - Intergenic
945210896 2:207381061-207381083 TTGACTTCAGACTGCTGTGCTGG + Intergenic
945329732 2:208525402-208525424 TTGACTTCAGACTGCTGTGCTGG + Intronic
945409167 2:209488554-209488576 TTGATTTCAGACTGCTGTGCTGG - Intronic
945467037 2:210181583-210181605 TTGACTTCAGACTGCTGTGCTGG - Intergenic
945482210 2:210357569-210357591 TCAACTTCAGACTGCTGTGCTGG + Intergenic
945628252 2:212237951-212237973 TTGACTTCAGACTGCTGTGCTGG + Intronic
945927400 2:215819592-215819614 TCGACTTCAGACTGCTGTGCTGG - Intergenic
945945189 2:215988659-215988681 TCAACTTCAGACTGCTGTGCTGG - Intronic
946065318 2:216982578-216982600 TCCACTTCAGACTGCTGTGCTGG + Intergenic
946790222 2:223293496-223293518 TCAAATTCAGACTGCTGTGCTGG + Intergenic
946912988 2:224485389-224485411 TTGACTTCAGACTGCTGTGCTGG - Intronic
947033493 2:225824810-225824832 TTGACTCCAAACTGCTGTGCTGG - Intergenic
947086044 2:226454211-226454233 TTGACTACAGACTGCTGTGCTGG - Intergenic
947225853 2:227839562-227839584 TTGACTTCAGACTGCTGTGCTGG + Intergenic
947364676 2:229381544-229381566 TCGACTTCAGACTGCTGTGCTGG - Intronic
947681427 2:232037408-232037430 TCGACTTCAGACTGCTATGCTGG + Intronic
947774425 2:232696799-232696821 TTCATTTCAGAGTGTTGTACTGG - Intergenic
1169320055 20:4625196-4625218 TCCACTTCAGACTGCTGTGCTGG + Intergenic
1169397047 20:5241593-5241615 TGGACTTCAGACTGCTGTGCTGG + Intergenic
1169421335 20:5463252-5463274 TCGACCTCAGACTGCTGTGCTGG + Intergenic
1169654226 20:7904485-7904507 TCTACTTCAGACTGAAGTACTGG - Intronic
1169960346 20:11152634-11152656 TCGACTTCAGACTGCTGTTCTGG + Intergenic
1170082478 20:12491989-12492011 TTGATCTCAGACTGCTGTGCTGG - Intergenic
1170133907 20:13052658-13052680 TTGACTTCAGACTGCTGTGCTGG - Intronic
1170167902 20:13380950-13380972 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1170229396 20:14028295-14028317 TCCACTTCATACTGCTGTGCTGG + Intronic
1170266387 20:14470797-14470819 TCAGCTTCAGACTGCTGTGCTGG + Intronic
1170454595 20:16520295-16520317 TCCACTTCAGACTGCTTTGCTGG - Intronic
1170727341 20:18941725-18941747 TCCACCTCAGACTGCTGTGCTGG + Intergenic
1170919695 20:20665948-20665970 TTGCCTTGAGACTGCTCTGCAGG - Intronic
1171000845 20:21414101-21414123 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1171441384 20:25166203-25166225 TGGACTTCAGACTGCTATGCTGG - Intergenic
1171513402 20:25706576-25706598 TCGACCTCAGACTGCTGTGCTGG + Intergenic
1172466827 20:35161541-35161563 TCGACCTCAGACTGCTGTGCTGG - Intergenic
1173751166 20:45478034-45478056 TCAACTTCAGACTGCTGTGCTGG + Intronic
1175038501 20:56022976-56022998 TTGGCTTCTGGCTGCTGTATTGG - Intergenic
1176344434 21:5728780-5728802 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1176351248 21:5849364-5849386 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1176500393 21:7595676-7595698 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1176538755 21:8126849-8126871 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1176891782 21:14327432-14327454 TCAACTTCTGACTGCTGTGCTGG - Intergenic
1177042709 21:16133067-16133089 TTGACTTCAGACTGCTATGCTGG + Intergenic
1177050275 21:16224869-16224891 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1177058213 21:16335838-16335860 TTGTTTTCATACTGCTTTACAGG + Intergenic
1177129665 21:17240738-17240760 TTGACTTCAAACTGTTGTGCTGG - Intergenic
1177184196 21:17775615-17775637 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1177313234 21:19424430-19424452 TTGACTTCAGACTGATGTGCTGG - Intergenic
1177425887 21:20922368-20922390 TCAACTTCTGACTGCTGTTCTGG - Intergenic
1177517918 21:22178194-22178216 TCAACTTCAGACGGCTGTGCTGG - Intergenic
1177540988 21:22493763-22493785 TCAACTTCAGTCTGCTGTGCTGG - Intergenic
1178007097 21:28234309-28234331 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1178393560 21:32219742-32219764 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1178864450 21:36316549-36316571 TCGACTTCAGATTGCTGTGCTGG + Intergenic
1180596231 22:16975277-16975299 TTGACTTCAGACTGTTGTGCTGG - Intronic
1182204486 22:28609854-28609876 TCGACCTCAGACTGCTGTGCTGG - Intronic
1182870312 22:33640701-33640723 TAGACTTCAGACTGCTGTGCTGG - Intronic
1182952497 22:34390684-34390706 TCGACTTCAGACTGCTATGCTGG + Intergenic
1183021497 22:35030818-35030840 TCAACTTCAGCCTGCTGTGCTGG + Intergenic
1183182719 22:36271769-36271791 TCAACTTCAGGCTGCTGTGCTGG + Intergenic
1203243703 22_KI270733v1_random:43204-43226 TCAACTTCAGACTGCTGTGCTGG + Intergenic
949173881 3:1034996-1035018 TGGACTTCAGACTGCTGTGCTGG + Intergenic
949217455 3:1586890-1586912 CTGACTTCAAACTGTTCTACAGG + Intergenic
949423532 3:3891495-3891517 TCAACTTCAGACTGCTCTTCTGG + Intronic
949580614 3:5384149-5384171 TTGACTTCAGACTGCTGTGCTGG + Intergenic
949583362 3:5412787-5412809 TTGACTTCAGACTGCTGTACTGG - Intergenic
949594600 3:5530848-5530870 TCAACATCAGACTGCTGTGCTGG + Intergenic
949641039 3:6036261-6036283 TTGACATCAGACAGCTGTGCTGG + Intergenic
949801199 3:7906209-7906231 TCAACTTCAGATTGCTGTGCTGG + Intergenic
949955047 3:9260416-9260438 TCGACTTTAGAGTGCTGTGCTGG - Intronic
950561983 3:13736249-13736271 TCGACCTCAGACTGCTGTGCTGG + Intergenic
950597459 3:13997153-13997175 TCGACTTCAGACTGCTGTGCTGG + Intronic
950992024 3:17449501-17449523 TCGACTTCAGATTGCTGTGCTGG - Intronic
951254496 3:20432987-20433009 TCGACTTCAGGCTGCTGTGCTGG + Intergenic
951310906 3:21125123-21125145 ACAACTTCAGACTGCTGTGCTGG - Intergenic
951415135 3:22414415-22414437 TTGACTTCAGACTGCTGTGCTGG + Intergenic
951503678 3:23417931-23417953 TCGACTTCAGACTGCTGTGCTGG + Intronic
951629123 3:24699342-24699364 TCAACTTCAGACTGCTGTGCTGG + Intergenic
951687604 3:25362362-25362384 TCAACTTCAGACTGCTGTGCTGG + Intronic
951741667 3:25931736-25931758 TGGACTTCAGACTGCTGTGCTGG - Intergenic
951777255 3:26323950-26323972 TCGACCTCAGACTGCTGTGCTGG + Intergenic
951795491 3:26533875-26533897 TCAACTTCAAACTGCTGTGCTGG + Intergenic
951826663 3:26876104-26876126 TCGACTTCTGACTACTGTCCTGG - Intergenic
951832156 3:26942877-26942899 TCAACTTCAGACTGCTGTGCTGG - Intergenic
951939244 3:28059629-28059651 TTGATCTCAGACTGCTGTGCTGG - Intergenic
952098616 3:29985254-29985276 TGGACTTCAGACTGCTGTGCTGG + Intronic
953047233 3:39304795-39304817 TTGACTTCAGACTGCTGTTCTGG - Intergenic
953074054 3:39551461-39551483 TAGACTTCAGACTGCTATGCTGG - Intergenic
953102357 3:39842333-39842355 TCGACTTCAGACTGCCGTGCTGG + Intronic
953286643 3:41616901-41616923 TCAATTTCAGACTGCTGTGCTGG - Intronic
954490629 3:50901347-50901369 TCAACTTCAGACTGGTGTGCTGG + Intronic
954508199 3:51097479-51097501 TTGAATTCAGAGTGCTCTGCTGG + Intronic
954510503 3:51120839-51120861 TTGACTTCAGACTTGTGCGCTGG + Intronic
954524945 3:51261679-51261701 TCGACATCAGACTGCTGTGCTGG - Intronic
954531074 3:51320592-51320614 TCGACCTCGGACTGCTGTGCTGG - Intronic
955414299 3:58678470-58678492 TCGACTTCAGACTGCTGTGCTGG + Intergenic
955447802 3:59032465-59032487 TTGACTTTAGACTGCTGTGCTGG - Intronic
955453983 3:59100400-59100422 TCGACTTCAGACTGCTGTGTTGG + Intergenic
955657836 3:61263682-61263704 CCGACTTGAGACTGCTGTGCTGG + Intergenic
956157338 3:66312356-66312378 TCGACTTCAGAATGCTTTGCTGG + Intronic
956207728 3:66771696-66771718 TTGACTTCAAACTGCTATGCTGG + Intergenic
956220082 3:66893293-66893315 TTGACTTCAGACTGCTGTGCTGG - Intergenic
956242131 3:67142290-67142312 TTTACTTCAGACTGCTGCGCTGG + Intergenic
956243400 3:67154539-67154561 TTGAGCTCAGACTGCTGTGCTGG - Intergenic
956279355 3:67540319-67540341 TGGACTTCAGACTGATGTGCTGG - Intronic
956355715 3:68390121-68390143 TTGACTTCAGACTGCTGTGCTGG - Intronic
956383071 3:68686329-68686351 TAAACTTCAGACTGCTGTACTGG + Intergenic
956398125 3:68847391-68847413 TCAACTTCAGACTGCTGTGCTGG + Intronic
956753032 3:72359958-72359980 GAGACTCCAGACTGCTGTCCAGG + Intergenic
957009364 3:74986215-74986237 TCGGCTTTAGACTGCTGTGCTGG + Intergenic
957011239 3:75008442-75008464 TTCACTTCAGACAGCTGTGCTGG + Intergenic
957474840 3:80709697-80709719 TTGACTTCAGACTGCTGTGCTGG - Intergenic
957695712 3:83635980-83636002 TTGAATTCAGACTGCTGTGCAGG - Intergenic
957776491 3:84761277-84761299 TCGACTTCAGACTGCTGTGCTGG - Intergenic
957850445 3:85800259-85800281 TTGACTTCAGACTGCTCTGCTGG + Intronic
958520921 3:95184626-95184648 TCGACTTCAGATTGCTGTGCTGG + Intergenic
959009038 3:101052818-101052840 TTGAATTCAGACAGATGTATGGG + Intergenic
959025645 3:101236983-101237005 TTGACTTCAGGCTGCTGTGCTGG - Intronic
959074544 3:101735963-101735985 TCGACTTCAGACTGCTGTACTGG - Intronic
959091819 3:101911328-101911350 TCAACCTCAGACTGCTGTGCTGG + Intergenic
959093075 3:101924917-101924939 TTGACTTCAGACTGCTGTGCTGG + Intergenic
959120117 3:102222964-102222986 TCAACTTCACACTGCTGTGCTGG + Intronic
959278210 3:104304579-104304601 TCAACTGCAGACTGCTGTGCTGG - Intergenic
959291883 3:104485214-104485236 TCAACTTCAGATTGCTGTGCTGG - Intergenic
959453761 3:106534321-106534343 TTGACTTTAGACTGCTGTGCTGG - Intergenic
959505910 3:107156272-107156294 TTGACTTCAGACTGCTGGGCTGG - Intergenic
959534601 3:107470627-107470649 TCGACTTCAGACTGCTGTGCTGG - Intergenic
959734976 3:109648166-109648188 TCAACTTCAGACTACTGTGCTGG - Intergenic
959800993 3:110495284-110495306 TCGACTTCAGGCTGCTGAGCTGG - Intergenic
959842862 3:110998889-110998911 TCAACTTCAGACTGCTGTGCTGG - Intergenic
959875686 3:111379806-111379828 TAGACTTCAGACTGCTGTGCTGG - Intronic
959881204 3:111446979-111447001 TCAACTTCAGACTGCTGTGCTGG + Intronic
960177275 3:114532254-114532276 TCAACTTCAGACTGCCGTGCTGG - Intronic
960226914 3:115179483-115179505 TTGACTTCACACTGCTGTGCTGG + Intergenic
960378128 3:116928159-116928181 TCGACTTCAGCCTGCTGTGCTGG + Intronic
960491637 3:118322486-118322508 TTGACTTCAGACTGCTGTGCTGG + Intergenic
960579828 3:119267441-119267463 TCAAGTTCAGACTGCTGTGCTGG - Intergenic
960655937 3:120004144-120004166 TTGATCTCAGACTGCTGTGCTGG - Intronic
960773159 3:121217055-121217077 TCGACCTCAGACTGCCGTGCTGG + Intronic
960827881 3:121811533-121811555 TCGACTTCAGACTGTTGTGCTGG - Intronic
961958779 3:130832207-130832229 TCGATCTCAGACTGCTGTGCTGG - Intergenic
961998255 3:131269141-131269163 TTGACTTCAGACTGCTGTGCTGG + Intronic
962064378 3:131963507-131963529 TCGACTTCAGACTGCTTTGCTGG - Intronic
962156858 3:132956987-132957009 TCGACTTTAGACTGCTGTGCTGG - Intergenic
962462402 3:135626697-135626719 CTGATTTCAGACTGGTGTATTGG - Intergenic
962512344 3:136114551-136114573 TTGACCTCAGACTGTTGTGCTGG - Intronic
962634784 3:137319460-137319482 TCGACTTCAAACTGCTGTGCTGG + Intergenic
962640140 3:137377178-137377200 TCAACTTCAGACTGCTGTACTGG + Intergenic
962642361 3:137400695-137400717 TTGACGTCAGATTGCTGTGCTGG + Intergenic
962668388 3:137679611-137679633 TTGACCTCAGACTGCTGTGCTGG - Intergenic
962765712 3:138560639-138560661 TTGACCTCAGACTGCTGCGCTGG - Intronic
963027441 3:140933651-140933673 TTGACTTCTGACTCCTGTACTGG - Intergenic
963481442 3:145879568-145879590 TTGACTTCTGACTGCTATGCTGG + Intergenic
963629298 3:147713034-147713056 TTCACTTCAGACTGCTGTGCTGG + Intergenic
963898659 3:150712409-150712431 TTGACTTCAGACTGTTGTGCTGG - Intergenic
963976318 3:151484067-151484089 TTGAGCTCAGACTGCTGTGCTGG - Intergenic
963980236 3:151528970-151528992 TTGACCTCAGACTGCTGTGCTGG - Intergenic
963998564 3:151739884-151739906 TTGACTTCAGACTGCTGTGCTGG + Intronic
964010366 3:151885409-151885431 TTGACATCTGACTGCTGTGCTGG - Intergenic
964049484 3:152373172-152373194 TCGACTTCAGACTGCTGTGCTGG + Intronic
964053296 3:152421430-152421452 TTGACTTCAGACTGCTAGGCTGG - Intronic
964378029 3:156069035-156069057 TCCACTTCAGACTACTGTGCTGG + Intronic
964391255 3:156200684-156200706 TCAACTTCAGACTGCTGTGCTGG + Intronic
965025496 3:163297033-163297055 TCTACTTCAGACAGCTGTGCTGG - Intergenic
965293186 3:166909766-166909788 TCGACTTCAGACTGCTGTGCTGG + Intergenic
965324761 3:167289852-167289874 TTGAGCTCAGACTGCTGTGCTGG - Intronic
965382811 3:168011417-168011439 TTGATCTCAGACTGCTGTGCTGG - Intronic
965511102 3:169568485-169568507 TGGACTTCAGACTGCTGTGCTGG - Intronic
965618733 3:170621528-170621550 TTGATTTCAGATTACTGTGCAGG + Intronic
965880450 3:173382418-173382440 TCAACTTCAGACTGCTGTGCTGG - Intergenic
966251073 3:177865975-177865997 TCAACTTCAGACTGCTGTGCTGG - Intergenic
966255107 3:177908552-177908574 TCGACTTCAGACTGCTGTGCTGG + Intergenic
966255135 3:177908738-177908760 TCAACTTCAGACTGCTGTGCTGG - Intergenic
966291194 3:178361374-178361396 TCGACTTCAGACTGATGTGCTGG - Intergenic
966309404 3:178576609-178576631 TCGACTTCAGACTGCTGTGCTGG - Intronic
966409427 3:179633144-179633166 TTGCCTCCAAACTGCTGTCCTGG - Intergenic
966533303 3:181004380-181004402 TTGACTTTAGACTGCTATGCTGG + Intergenic
966637919 3:182156580-182156602 TTGACTTTAGACTGCTGTGCTGG + Intergenic
967181502 3:186909410-186909432 TCAACTTCAGACTGCTGCGCTGG + Intergenic
967343543 3:188427785-188427807 TCAACTTCAGACTGCTGTGCTGG + Intronic
967419575 3:189258876-189258898 TCGACTTCAGACTGCTGTGTTGG + Intronic
967562667 3:190934884-190934906 TTGACTTCAGACTGCTGTGCTGG + Intergenic
967715576 3:192758314-192758336 TTGACTTCAGACTGCTGTACTGG - Intronic
967985025 3:195088058-195088080 TTGATCTCAGACCGCTGTGCTGG - Intronic
968829109 4:2923011-2923033 TCGACTTCAGACTGCTGTGCTGG + Intronic
969164816 4:5298662-5298684 TTGACTTTAGACTGCTGTGCTGG + Intronic
969190889 4:5518567-5518589 TTGATCTCAGACTGCTGTGCTGG - Intergenic
969909194 4:10427945-10427967 TCGACTTCAGACTGCTGTGCTGG + Intergenic
970120451 4:12747238-12747260 TAGAGTTCCGACTGCTGTTCTGG - Intergenic
970185370 4:13446239-13446261 CCGACTCCAGACTGCTGTGCTGG + Intronic
970214534 4:13745249-13745271 TTGACTTCAGACTGCTGTGCTGG + Intergenic
970304714 4:14719208-14719230 TTGACTTCTGACTGCTGTGCTGG - Intergenic
970412040 4:15818120-15818142 TCAACTTCAGACTGCTGTGCTGG - Intronic
970679370 4:18489435-18489457 TCAACTTCAGACTGCTGTGCTGG - Intergenic
970679479 4:18490054-18490076 TCAACTTCAGACTGCTGTGCTGG + Intergenic
970685242 4:18559684-18559706 TCTACTTCATACTGCTGTGCCGG - Intergenic
970714712 4:18908014-18908036 TCAACTTCAGACTTCTGTGCTGG - Intergenic
970727176 4:19060407-19060429 TCAACTTCAGACTGCTGTGCTGG - Intergenic
971647681 4:29229881-29229903 TTGACTTCAGACTGCTGTGCTGG - Intergenic
971673609 4:29595549-29595571 TTAACTTCAGACTGCCATGCTGG + Intergenic
971697876 4:29929895-29929917 TCAACTTCAGACTGCTGTGCTGG - Intergenic
971883240 4:32409651-32409673 TTGACTTCAGACTGCTGTATGGG - Intergenic
971943198 4:33241446-33241468 TTGACTTCGGACTGCTGTGTTGG + Intergenic
972219317 4:36935887-36935909 TCATCTTCAGACTGCTGTGCTGG - Intergenic
972743281 4:41909382-41909404 TCAACTTCAGACTCCTGTGCTGG + Intergenic
972755560 4:42042326-42042348 TCAACTTCAGACAGCTGTGCTGG - Intronic
973081861 4:46003148-46003170 TCGACTTCAAACTGCTGTGCTGG + Intergenic
973128165 4:46614867-46614889 TTGTGTTCTGACTGCTATACTGG + Intergenic
973272998 4:48280180-48280202 TCGACTTCAGACTGCTGTGCTGG - Intergenic
973321812 4:48817694-48817716 TTGTCTTCAGACTGCTGTGCTGG - Intronic
973562640 4:52151765-52151787 TTGACTTCAGACTGCTATGCTGG - Intergenic
973568021 4:52207861-52207883 TCGACTTCAGACTGCTGTACTGG - Intergenic
973629101 4:52802225-52802247 TTGGCTTCAGACTGCTGTGCTGG - Intergenic
973630625 4:52816843-52816865 TTGATCTCAGACTGCTGTGCTGG - Intergenic
973715225 4:53669690-53669712 TCGACATCAGACTGCTGTGCTGG + Intronic
973914480 4:55619538-55619560 TTGATCTCAGACTGCTGTGCTGG - Intronic
974251786 4:59394378-59394400 TCAACTTCAGACTGCTGTGCTGG + Intergenic
974263981 4:59560479-59560501 TCGACTTCAGACTGCTGTGCTGG + Intergenic
974302053 4:60081551-60081573 TTGACTTCAGACTGCTATGCTGG - Intergenic
974326308 4:60419234-60419256 TTGACTTCAAACTGCTATGCTGG + Intergenic
974427577 4:61760396-61760418 TTGATCTCAGACTGCTGTTCTGG + Intronic
974536492 4:63182137-63182159 TAGATCTCAGACTGCTGTGCTGG - Intergenic
974613132 4:64242175-64242197 TTGACTTCATATTGTTGTATTGG + Intergenic
974792998 4:66714162-66714184 TCAACCTCAGACTGCTGTGCTGG - Intergenic
974813955 4:66982011-66982033 TCGACTTCCGATTGCTGTGCTGG - Intergenic
974814705 4:66989392-66989414 CAGACTCCAGACTGCTGTGCTGG + Intergenic
974851791 4:67412611-67412633 TTGACTTCAGACTGCTGTGCTGG + Intergenic
974946628 4:68536267-68536289 TTGACTTCAGATTGCTGTGCTGG + Intergenic
975104112 4:70548864-70548886 TCAACTTCAGACTGCTGTGCTGG - Intergenic
975149413 4:71004832-71004854 TTGACTTCAGACTGCTGTGCTGG + Intronic
975177904 4:71308996-71309018 TCGACTTCAGACTGCTGTGCTGG - Intronic
975297377 4:72750246-72750268 TTGATTTCAGACTGTTGTGCTGG - Intergenic
975367353 4:73544720-73544742 TCCAGTTCAGACTGCTGTGCTGG - Intergenic
975424981 4:74215076-74215098 CCGACTTCAGACTGCTATGCTGG + Intronic
975466348 4:74713834-74713856 TTGACTTCAGACTGCTGTGCTGG + Intergenic
975479325 4:74860092-74860114 TTGACTTCAGACTGTTCTGCTGG - Intergenic
975484180 4:74916066-74916088 TCGACTTCAGAATGCTGTGCTGG + Intergenic
975524244 4:75331567-75331589 TGCACTTCAGACTGCTGTTCTGG - Intergenic
975533063 4:75420805-75420827 TTGACTTCAGACTGCTGTACTGG + Intergenic
975620340 4:76290510-76290532 TTGACTTCAGACTGCTGTGCTGG + Intronic
975764680 4:77655012-77655034 TCAACTTCAGACTGCTGTGCTGG - Intergenic
975963847 4:79945033-79945055 TTGATTTCAAACAGCTTTACTGG + Intronic
976006797 4:80439818-80439840 TCGACTTCAGACTGCTGTGATGG - Intronic
976023940 4:80664603-80664625 TTGACTTTAGACTGCTGTGCTGG + Intronic
976061263 4:81130857-81130879 TCGACTTCAGACTGCTGTGCTGG + Intronic
976065550 4:81183760-81183782 TTGACTTCAGACTGCTGTACTGG - Intronic
976114846 4:81715505-81715527 TAGATTTCAGACTGCTGTGCTGG - Intronic
976363055 4:84202878-84202900 TTGACTTCAGACTGCTGTGCTGG - Intergenic
976370804 4:84286199-84286221 TCAACTTCAGACTGCTGTGCTGG - Intergenic
976394909 4:84545220-84545242 TCTACTTCAGACTGCTGTGCTGG - Intergenic
976445986 4:85129989-85130011 TCAACTTCAGACTGCTGTGCTGG + Intergenic
976585377 4:86791241-86791263 TTGATCTCAGACTGCTGCGCTGG - Intronic
976655930 4:87488963-87488985 TCAACTTCAGACTGCTGTGCTGG + Intronic
976715935 4:88122437-88122459 TTGACTTTAGACTGCTGTGCTGG - Intronic
976809941 4:89089900-89089922 TCAACTTCAGACTGCTGTGCTGG + Intronic
976903523 4:90208376-90208398 TCGACTTCAGACTGCTGTACTGG + Intronic
977046900 4:92079252-92079274 TTGACTTCAGACTGCTGTGTTGG - Intergenic
977154469 4:93555375-93555397 TCGACTTGAGACTTCTGTGCTGG - Intronic
977185659 4:93932671-93932693 TCGACTTCAGACTGCTGTGCTGG + Intergenic
977425534 4:96863136-96863158 TGGACTTCAGACTGCTGTGCTGG - Intergenic
977438973 4:97037969-97037991 TTGACTTCAGACTGCTGTGCTGG + Intergenic
977500268 4:97828660-97828682 TCAACCTCAGACTGCTGTGCTGG - Intronic
977631478 4:99248072-99248094 TTGACTTCAGACTGCTTTCCTGG + Intergenic
977632976 4:99263685-99263707 TTTACTTCAGACTGTTGTGCTGG + Intergenic
977671385 4:99699337-99699359 TCGACTTCAGGCTGCTGTGTTGG - Intergenic
977723488 4:100267647-100267669 TTGACTTCAGACTGCTGTGCTGG + Intergenic
977774422 4:100900712-100900734 TCAACTTCAGACTGCTGTGCTGG - Intergenic
977792936 4:101129014-101129036 TCAACTTCAGACTGCTGTCCTGG - Intronic
977887882 4:102273212-102273234 TTGACTTCAGACTGCTGTGCTGG - Intronic
977986175 4:103385662-103385684 TTGACTTCACACTGCTGTGATGG - Intergenic
977994453 4:103485023-103485045 TCGACTTCAGCCTGCTCTGCTGG - Intergenic
978060162 4:104327223-104327245 TTGATCTCAGACTGCTGGGCTGG + Intergenic
978078887 4:104568024-104568046 TTGATTTCAGACTGCTGTGCTGG + Intergenic
978090287 4:104707119-104707141 TCGACTTCAGACTGCTGTGCTGG - Intergenic
978108266 4:104930826-104930848 TTGACTTCAGACTGCTCTGCTGG - Intergenic
978139063 4:105297212-105297234 TCAACTTCAGACTACTGTGCTGG - Intergenic
978179536 4:105776211-105776233 TTGCCTTCAGACTGCTGTGCTGG + Intronic
978186062 4:105858283-105858305 TCGACTTCAGACTGCTGTGCTGG + Intronic
978186308 4:105860509-105860531 TTGACCTCAGACTGCTGTGCTGG - Intronic
978278335 4:106978614-106978636 TCGACTTCAGACTTCTGTCCTGG + Intronic
978313276 4:107409557-107409579 TTGACTTCAGATTGCTGTGCTGG - Intergenic
978601422 4:110432039-110432061 TCAACTTCAGACTGCTGTGCTGG + Intronic
978664289 4:111164295-111164317 TCGACTTCAGACTGCTCTGCTGG - Intergenic
978699773 4:111628326-111628348 TCAACTTCAGACTGCTGTGCTGG + Intergenic
978845566 4:113269148-113269170 TTAACTTCAGACTGCTGTGCTGG + Intronic
978906638 4:114013041-114013063 TCGACTTCAGACTGCTGTGTTGG + Intergenic
979012318 4:115387514-115387536 TCAACTTCAGACTGCTGTGTTGG - Intergenic
979043678 4:115834524-115834546 CTGACTTCAGACTGCTGCGCTGG - Intergenic
979417455 4:120460923-120460945 TTGACTTCAGACTGCTGTGGTGG - Intergenic
979421387 4:120509379-120509401 TCAACTTCAGACTGCTGTGCTGG - Intergenic
979457594 4:120944334-120944356 TCGACTTCAGACTGCTGTGCTGG - Intergenic
979461614 4:120990568-120990590 TTGACTTCAGACTGCTGTGCTGG + Intergenic
979564020 4:122134132-122134154 GTGTCTTCAGACTGCCATACCGG + Intergenic
979668282 4:123336558-123336580 TTGACTTCAGACTGCTGTGCTGG + Intergenic
979705358 4:123713845-123713867 TTGACTTCAGACTGCTGTGCTGG - Intergenic
979730152 4:124014152-124014174 TTGATCTCAGACTGCTGTGCTGG + Intergenic
980151673 4:129055646-129055668 TGGACTTCAGACTTCTGTGTTGG + Intronic
980157638 4:129126396-129126418 TCGACTTCGGACTGCTGTGCTGG + Intergenic
980200594 4:129651817-129651839 TTGACTTCAGACTGCTGTGCTGG - Intergenic
980223311 4:129947839-129947861 TTGACTTCAGACTTCTGTGCTGG + Intergenic
980451706 4:132981771-132981793 TTGGCTTCAGACTTCTGGCCAGG - Intergenic
980494175 4:133570178-133570200 TAGATTTCAGACTGCTGTGTTGG + Intergenic
980583643 4:134786479-134786501 TTTACATCAGACTGCTGTGCTGG + Intergenic
980687851 4:136253632-136253654 TTGACTTCAGGCTGCTGTGCTGG - Intergenic
980769325 4:137351145-137351167 TCAACTTCAGACTGCTGTGCTGG - Intergenic
980888134 4:138785499-138785521 TTGACTTCAGACTGCTGTCCTGG + Intergenic
981131574 4:141163069-141163091 TCAACTTCAGACTGCTGTGCTGG - Intronic
981133984 4:141189772-141189794 TTGACTTCAGACTGCTGTGCTGG + Intronic
981296652 4:143140632-143140654 TTGACTTCAGACTGCTGTACTGG - Intergenic
981411247 4:144435195-144435217 TCAACTTCAGACTGCTCTGCTGG - Intergenic
981419124 4:144528905-144528927 ATGACTTCAGACTGTTATCCAGG + Intergenic
981443470 4:144809147-144809169 TTGACTTCAGACTGCTGTGCTGG - Intergenic
981481475 4:145243354-145243376 TCCACTTCAGACTACTGTGCTGG + Intergenic
981629686 4:146804501-146804523 TTGACTTCAGACTGCTATGCTGG - Intronic
981648119 4:147022937-147022959 CTGACTTCAGACTACACTACAGG - Intergenic
981671539 4:147292726-147292748 TCGACTTCAGACTGCTGTGCTGG - Intergenic
981749852 4:148082836-148082858 TCGACTTCAGACTGCTGTGCTGG - Intronic
981787987 4:148502750-148502772 GTGAGCTCAGACTGCTGTGCTGG + Intergenic
981789633 4:148521779-148521801 TTGACTTCAGACTGCTGTGCTGG + Intergenic
981794949 4:148585470-148585492 TCAACTTCAGACTGCTGTGCTGG + Intergenic
981859853 4:149341408-149341430 TCGACCTCAGACTGCTGTGCTGG + Intergenic
981939931 4:150271482-150271504 TCAACTTCAGACTGCTGTGCTGG - Intronic
981939960 4:150271625-150271647 TCAACTTCAGACTGCTGTGCTGG - Intronic
982060279 4:151597903-151597925 TCGACTTCAGACTGTTGTGCTGG + Intronic
982298966 4:153859605-153859627 TTGACTTCAGACTGCTGTGCTGG + Intergenic
982323870 4:154109048-154109070 TTGACTTCAGACTGCTGTGCTGG - Intergenic
982393617 4:154892260-154892282 TCGACTTCAAACTGCTGTGCTGG - Intergenic
982548224 4:156761087-156761109 CTGTCTTCAGACTGCTCTTCAGG - Exonic
982725609 4:158902859-158902881 TCGACCTCAGACTGCTGTGCTGG + Intronic
982794543 4:159629600-159629622 TTGACTTCAGACTGCTGTGCTGG + Intergenic
982815392 4:159877780-159877802 TTGACTTCAGACTGCTGTGCTGG + Intergenic
982825729 4:160001921-160001943 TCAACTTCAGACTGCTGTGCTGG - Intergenic
982848148 4:160276818-160276840 CTGACTCCAGGCTGCTGTGCTGG - Intergenic
983044525 4:162969736-162969758 TCAACTTCAGACTGCTGTGCTGG + Intergenic
983169597 4:164520906-164520928 CAGACTCCAGACTGCTGTGCTGG + Intergenic
983179448 4:164630708-164630730 TCAACTTCAGACTGCTGTGCTGG - Intergenic
983246659 4:165295555-165295577 TTGATTACAGAATGCTGTAAAGG + Intronic
983299037 4:165902117-165902139 TTGACTTTAGACTGCTGTGCTGG + Intronic
983331392 4:166333614-166333636 TCGACTTCAGACTGCTGTGCTGG + Intergenic
983485901 4:168331237-168331259 TCGACTTCAGACTGCTGTGCTGG + Intergenic
983596312 4:169471985-169472007 TCAACTTCAGACTGCTGTGCAGG + Intronic
983602748 4:169548842-169548864 TAGAGTTCAGACTGCTGTGCCGG + Intronic
983896229 4:173084686-173084708 TTGACTTCAGACTGCTGTGCTGG + Intergenic
983949457 4:173622427-173622449 TTGACTTCAGACTGCTGTGCTGG + Intergenic
983958811 4:173727821-173727843 TTGACTTCAGACTGCTGTGCTGG + Intergenic
984493674 4:180468692-180468714 TCCACTTCAGGCTGCTGTGCTGG - Intergenic
984618640 4:181927289-181927311 TCGATTTCAGACTGCTGTGCTGG - Intergenic
984902948 4:184600947-184600969 TCAACTTCAGACTGCTGTGCTGG - Intergenic
985194019 4:187408305-187408327 TCGACTTCAGACTGCTGTGTTGG + Intergenic
985317405 4:188672740-188672762 TCGACTCCAGACTGCTGTGCTGG - Intergenic
986006021 5:3669787-3669809 TTGACTTCAGCCTGCTGTGTTGG + Intergenic
986110351 5:4709907-4709929 TTGACTTCAGACTGCTGTGCTGG - Intergenic
986358535 5:6952361-6952383 TCATCTTCAGACTGCTGTGCTGG - Intergenic
986378837 5:7162677-7162699 TCAACTTCAGACTGCTGTGCTGG + Intergenic
986484339 5:8220279-8220301 TTGACTTCAGACTGCTGTGCTGG - Intergenic
986664968 5:10093855-10093877 TCAACTTTAGACTGCTGTGCTGG - Intergenic
987720579 5:21627778-21627800 TCGACTTCAGACTGGTGCGCTGG + Intergenic
987924092 5:24317842-24317864 TCGACTTCAGACTGCTGTGCTGG + Intergenic
988021445 5:25627211-25627233 TCGACTTCACACTGCTGTGCTGG - Intergenic
988289802 5:29270599-29270621 TCCACTTCAGACTGTTGTGCTGG - Intergenic
988402098 5:30775700-30775722 TTGACTTCAGACTGCTATGCTGG - Intergenic
988628026 5:32898738-32898760 TTGACTTCAGACTGCTGTGCTGG + Intergenic
988719205 5:33859275-33859297 TCAACTTCAGACTGCTGTGCTGG - Intronic
988774977 5:34469362-34469384 TCGACGTCAGACTGCTGTGCTGG - Intergenic
988867711 5:35353930-35353952 TTGACTTCAGACTGCTGTGCTGG + Intergenic
988917737 5:35912113-35912135 TTGGTCTCAGACTGCTGTGCTGG - Intronic
988970785 5:36465501-36465523 TCAACTTCAGACTGCTGTGCTGG - Intergenic
989084081 5:37656820-37656842 TCAACTTCAGACTGCTGTGCTGG + Intronic
989194160 5:38699899-38699921 TCAACTTCAGACTGCTGTGCTGG - Intergenic
989320715 5:40130925-40130947 TTGACTTCAGACTGATATGCTGG + Intergenic
989363939 5:40634728-40634750 TTGACTTCAGACTGCTGTGCTGG - Intergenic
989563601 5:42878217-42878239 TGAACTTCAGACTGCTGCAAAGG + Intronic
989619051 5:43367106-43367128 TGGACTTCAGACTGCTGTGCTGG + Intergenic
989675247 5:43965816-43965838 TAGAGCTCAGACTGCTGTGCTGG + Intergenic
989824619 5:45838439-45838461 TTGATCTCAGACTGCTGTGCTGG + Intergenic
989825333 5:45848068-45848090 TTGACTTCAGACTGCTGTGCTGG - Intergenic
990098851 5:52156909-52156931 TTGACTTCAGACTACTGTGCTGG - Intergenic
990164339 5:52977784-52977806 TTGACTTCTGACTGCTGTGCTGG + Intergenic
990291436 5:54355668-54355690 TTGACTTCAAACTACACTACAGG - Intergenic
990442543 5:55861207-55861229 ATGCCTTCAGACTTCTGTCCTGG + Intronic
990673887 5:58162195-58162217 TCGACTTCAGACTGCTGTGCTGG + Intergenic
990745861 5:58958961-58958983 TTGACTTCAGACTGCTGTGGTGG + Intergenic
990803501 5:59632009-59632031 TCGACTTCAGGCTGCTATACTGG - Intronic
990837800 5:60042073-60042095 TCCACTTCAGACTGCTGTGCTGG - Intronic
990860389 5:60320220-60320242 TTGAACTCAGACTGCTGTGCTGG + Intronic
990897598 5:60715788-60715810 TTGGCTTCAGACTGCTATGCTGG + Intergenic
991223568 5:64243351-64243373 TCAACTTCAGACTGCTGTGCTGG - Intronic
991242328 5:64474316-64474338 TCTACTTCAGACTGCTGTGCTGG - Intergenic
991283241 5:64939990-64940012 TCAACTTCAGACTACTGTGCTGG + Intronic
991397756 5:66222720-66222742 TTGACTTCAGACTGCTGTGCTGG + Intergenic
991652066 5:68865534-68865556 TTGACTTCAGACTGCTGTGCTGG - Intergenic
991934759 5:71790366-71790388 TCAACTTCAGACTACTGTGCTGG - Intergenic
992038880 5:72808903-72808925 TCAACTTCAGACTGCTGTGCTGG + Intergenic
992077858 5:73207336-73207358 TCGACTTCAGACTGCTGTGCTGG - Intergenic
992287281 5:75248410-75248432 TCAACTTCAGACTGTTGTGCTGG - Intergenic
992292437 5:75293117-75293139 TCGACTTCAGACTGCTGTGCTGG + Intergenic
992383853 5:76265326-76265348 TGGACTTCAGACAGCTGTGCTGG + Intronic
992506079 5:77388945-77388967 TTGACCTTAGACTACTGTGCCGG + Intronic
992908708 5:81373635-81373657 TTGATCTCAGACTGCTGTGCTGG - Intronic
992976906 5:82130217-82130239 TCGACTTCAGACTGCTATGCTGG + Intronic
992977703 5:82138099-82138121 TTGACTTCAGACTGCTGTGCTGG + Intronic
993255725 5:85588100-85588122 TCGACTTCAGACTGCTGTGCTGG + Intergenic
993381858 5:87217741-87217763 TGGACATCAGACTGCTGTGCTGG + Intergenic
993410482 5:87567400-87567422 TCAACTTCAGACTGCTGTGCTGG + Intergenic
993455276 5:88120498-88120520 TAGACTTCAGACTGCTGTGTTGG - Intergenic
993541624 5:89159446-89159468 TTGACTACAGACTGCTGTGCTGG - Intergenic
993609011 5:90031776-90031798 TCGACTTCAGAGTGCTATGCTGG - Intergenic
993757629 5:91751086-91751108 TTGACTTCAGACTGCTCTGCTGG + Intergenic
993894981 5:93523115-93523137 TCGACTTCATACTGCTGTGCTGG - Intergenic
993960964 5:94296279-94296301 TTGACTTCATACTGCTGTGCTGG + Intronic
994005170 5:94828820-94828842 TCGACTTCAGACTGCTGTGCTGG + Intronic
994143540 5:96367562-96367584 TCGATCTCAGACTGCTGTGCTGG + Intergenic
994233538 5:97336263-97336285 TCAACTTCAGACTGCTGTTCTGG + Intergenic
994369744 5:98954628-98954650 TTCACATCAGAGTGCGGTACAGG + Intergenic
994641956 5:102421388-102421410 TTGACTTCAGACTGCTGTGTTGG - Intronic
994918048 5:106004745-106004767 TCAACTTCAGACTGCTGTGCTGG + Intergenic
995263784 5:110135830-110135852 CCAACTTCAGACTGCTGTGCTGG + Intergenic
995276570 5:110284387-110284409 TTGATCTCAGACTGCTGTGCTGG + Intergenic
995301914 5:110594573-110594595 CTGCCTTCAGACTGCTGTGCTGG - Intronic
995471218 5:112503859-112503881 TCAACTTCAGACTGCTGTGCTGG - Intergenic
995475038 5:112539221-112539243 TCGACTTCAGACTGCTATGCTGG - Intergenic
995612359 5:113923871-113923893 TTGACTTCAGACTGCTGTGCTGG - Intergenic
995620606 5:114021516-114021538 TCGACCTCAGACTGCTGTGCTGG - Intergenic
995658232 5:114450837-114450859 TTGACTTCAGATTGACCTACTGG + Intronic
995695737 5:114876486-114876508 TTGAGCTCAGACTACTGTGCTGG - Intergenic
995790657 5:115883074-115883096 TTGACTTCAGACTGCTGTGCTGG + Intronic
995808555 5:116080445-116080467 TTGACTTCAGACTGCTATGCTGG - Intergenic
995895611 5:117007058-117007080 TTGACTTCAAACTGTGCTACAGG - Intergenic
996129937 5:119769795-119769817 TAGACTTCAGACTACTATGCTGG - Intergenic
996242510 5:121221185-121221207 TCGACTTCAGATTGCTGTGCTGG - Intergenic
996270774 5:121602319-121602341 TCGACTTCAAACTGCTGTGCTGG - Intergenic
996280735 5:121726580-121726602 TTGACTTCAGTTGGCTGTGCTGG + Intergenic
996426625 5:123320201-123320223 TCAACTTCAGGCTGCTGTGCTGG + Intergenic
996427922 5:123335220-123335242 TCAACTTTAGACTGCTGTGCTGG + Intergenic
996592265 5:125160955-125160977 CCGACTCCAGACTGCTGTGCTGG - Intergenic
996987499 5:129584771-129584793 TCGACTTCAGACTGCTGTGCTGG + Intronic
997216642 5:132117027-132117049 TTGACCTCAGACTGCTGTGCTGG - Intergenic
997217850 5:132129292-132129314 TCAACTCCAGACTGCTGTGCTGG + Intergenic
997220376 5:132157314-132157336 TCAACTTCAGACTGCTGTGCTGG + Intergenic
997252286 5:132398393-132398415 TTGACTTCAGACAGCTGTGCTGG - Intergenic
998275491 5:140748823-140748845 TTGACTTCAGACTATACTACAGG - Intergenic
998691626 5:144594614-144594636 TTGACTTCAGACTGCTGTGCTGG + Intergenic
998752093 5:145333643-145333665 GTTACTTCAGACTGCTTTGCTGG + Intergenic
998927496 5:147142425-147142447 TCAACTTCAGACTGCTATGCTGG + Intergenic
998972786 5:147611057-147611079 TTGACTTCAGACTGCTGTGCTGG + Intronic
998976933 5:147658902-147658924 CTGACTCTAGACTGCTGTGCTGG + Intronic
999030076 5:148281157-148281179 TCGACCTCCGACTGCTGTGCTGG + Intronic
999468663 5:151831416-151831438 TCAACTTCAGACTGCTGTGCTGG - Intronic
999502383 5:152160181-152160203 TCGACTTCAGGCTGCTGGACTGG + Intergenic
999556804 5:152752219-152752241 TTGACTTTAGACTGCTGCACTGG - Intergenic
999602586 5:153283166-153283188 TTGACTTCTGACTGCTATGCTGG - Intergenic
999688312 5:154122422-154122444 TTAACTTCAGACTGCTGTGCTGG - Intronic
999947258 5:156610780-156610802 TTGATCTCAGACTCCTGTGCTGG + Intronic
999983923 5:156984705-156984727 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1000194774 5:158947060-158947082 TTGACTTCAGACTGCTGTGCTGG + Intronic
1000417485 5:160998131-160998153 TCAACTTCAGACTACTGTGCTGG + Intergenic
1000548059 5:162625975-162625997 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1000582222 5:163048515-163048537 TTAACTTCAGACTGTTGTGCTGG + Intergenic
1000590034 5:163146997-163147019 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1000798386 5:165693284-165693306 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1000820199 5:165973526-165973548 TTGACTTCAGACTGCAGTGCTGG + Intergenic
1000863109 5:166479938-166479960 TTGACTGAAGACTGGTGTACTGG + Intergenic
1000996109 5:167960571-167960593 TCAACTTCAGACTGCTGTGCTGG + Intronic
1001346389 5:170903357-170903379 TTGACTTCAGACTGCTGTGCTGG + Intronic
1001362678 5:171103474-171103496 TCGACTTCAGACTGCTGTGCTGG + Intronic
1002673101 5:180886164-180886186 TTGATCTCAGACTGCCGTGCTGG + Intergenic
1002673529 5:180889966-180889988 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1002781976 6:373939-373961 TTGAATTCAGGCTGCTGCAGCGG - Intergenic
1002868324 6:1143988-1144010 TGGACAGCAGGCTGCTGTACTGG - Intergenic
1002944798 6:1750839-1750861 TCAACTTCATACTGCTGTGCTGG - Intronic
1002996115 6:2286792-2286814 TTGACCTCAGACTGCTGTGCTGG - Intergenic
1003416896 6:5917719-5917741 TCAACTTTAGACTGCTGTGCTGG + Intergenic
1003713512 6:8619686-8619708 TCTACTTCAGACTGCTGTGCTGG + Intergenic
1004027984 6:11837455-11837477 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1004944481 6:20596536-20596558 TCAACTTCAGACTGCTGTGCTGG + Intronic
1005208552 6:23432693-23432715 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1005373493 6:25158576-25158598 TCGATCTCAGACTGCTGTGCTGG - Intergenic
1005376293 6:25185907-25185929 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1005378271 6:25207500-25207522 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1005597431 6:27392646-27392668 TTGACTTCAGAGTGCTGTAGGGG - Intronic
1005778366 6:29161903-29161925 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1005795756 6:29360033-29360055 TCGACTTCAGACTGCTGTGCTGG - Intronic
1005846115 6:29780155-29780177 TTGATCTCAGACTGCTGTGCTGG - Intergenic
1006003229 6:30982992-30983014 TTGTTTTCAGACGGCTGTATAGG - Intergenic
1006199958 6:32279483-32279505 TCGACTTCAGACTGCTATGCTGG - Intergenic
1006566856 6:34966883-34966905 TTGACCTCTCACTCCTGTACTGG - Intronic
1007858132 6:44879192-44879214 TCGACTTCAGACTGCTGTGCTGG - Intronic
1008176212 6:48270903-48270925 TTGACTTCAGACTGCTGTTCTGG + Intergenic
1008407602 6:51136313-51136335 TCCACTTCAGACTGCTGTGCTGG + Intergenic
1008425229 6:51349180-51349202 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1008575470 6:52856426-52856448 TCGAGCTCAGACTGCTGTGCTGG + Intronic
1008719139 6:54327721-54327743 TCAATTTCAGACTGCTGTGCTGG - Intronic
1008758411 6:54824868-54824890 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1008785110 6:55158572-55158594 TTGACTTCAGACTGCTGCACTGG - Intronic
1008896846 6:56566069-56566091 TCGACTGCAGACTGCTGTGCTGG + Intronic
1009026609 6:58007490-58007512 ATCACTTCCCACTGCTGTACAGG - Intergenic
1009188339 6:60600223-60600245 TTGATCTCAGACTACTGTGCTGG - Intergenic
1009202152 6:60758959-60758981 ATCACTTCCCACTGCTGTACAGG - Intergenic
1009264107 6:61532060-61532082 TGGACTTCAGATTGCTGTGTTGG - Intergenic
1009305906 6:62089094-62089116 TTGACTTCAGACTGCTGTGCTGG + Intronic
1009410605 6:63361394-63361416 TTGATCTCAGACTGCTGTGTTGG + Intergenic
1009455261 6:63848950-63848972 TTGACTTCAGACTGCTGTGCTGG - Intronic
1009458756 6:63887912-63887934 TCAACTTCAGACTGCTGTGATGG - Intronic
1009536669 6:64896717-64896739 TGGACTTCAGACTGTTGTGGTGG - Intronic
1009570175 6:65374668-65374690 TCGACTTCAGACTGCTGTGATGG - Intronic
1009740252 6:67734437-67734459 TGGACTCCAGACTGCAGTGCTGG + Intergenic
1009775895 6:68205875-68205897 TTGACATCAGACTGCTGTGCTGG - Intergenic
1009777113 6:68218828-68218850 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1009795068 6:68456182-68456204 TCGACTTCAGACTGCTGCGCTGG + Intergenic
1009797840 6:68495022-68495044 TGGACTTCAGACTGCTGTGCTGG - Intergenic
1009880505 6:69560736-69560758 TTGACTTCAGACTGTTGTGCCGG - Intergenic
1009945366 6:70336499-70336521 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1009959515 6:70501367-70501389 TCGGCTTCAGACTGCTGTGCTGG + Intronic
1010039153 6:71361194-71361216 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1010447005 6:75959737-75959759 TCAACTTCAGACTGCTGTGCTGG + Intronic
1010459465 6:76097813-76097835 TAGACTTCAGACTGCTGTACTGG - Intergenic
1010574942 6:77518778-77518800 TTAACTTCAGACTGCTGCGCTGG - Intergenic
1010668312 6:78655700-78655722 TCAACTTCAGACTGCTGTACTGG + Intergenic
1010680294 6:78791208-78791230 CTGACTTCAAACTACTGTACCGG + Intergenic
1010936580 6:81869861-81869883 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1010994002 6:82512546-82512568 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1011020699 6:82809366-82809388 TTGACTTCAGACTGCTTTGCTGG + Intergenic
1011137406 6:84115448-84115470 TTGACCTCAGACTGCTGTGCTGG + Intergenic
1011174097 6:84541088-84541110 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1011235584 6:85213032-85213054 TGGACTTCAGACTGCTGTGCTGG + Intergenic
1011301449 6:85878781-85878803 TCAATTTCAGACTGCTGTGCTGG + Intergenic
1011304506 6:85911279-85911301 CAGACTCCAGGCTGCTGTACTGG - Intergenic
1011318697 6:86065660-86065682 TCAACTTCAGACTGCTCTGCTGG + Intergenic
1011332755 6:86228239-86228261 TCGACTTCATACTGCTGTGCTGG + Intergenic
1011340307 6:86306758-86306780 TTGACTTCAGAGTGCTGTGCCGG + Intergenic
1011387687 6:86815506-86815528 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1011766263 6:90623378-90623400 CAGACTTCAGACTGCTGTGCTGG - Intergenic
1011776791 6:90739613-90739635 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1012043408 6:94238949-94238971 TTGACTTCAGACTGCTTTGCTGG - Intergenic
1012083077 6:94785313-94785335 TGGACTTCAGACTGCTGTGCTGG + Intergenic
1012127941 6:95454122-95454144 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1012207474 6:96478769-96478791 TTGACTTCAGACTGTTGTGCTGG + Intergenic
1012302888 6:97612216-97612238 CAGACTTCAGACTGCTGTGCTGG + Intergenic
1012343482 6:98157026-98157048 CAGACTCCAGACTGCTGTGCTGG + Intergenic
1012597121 6:101054024-101054046 TCGACTTCAGACTGCTGGGGTGG + Intergenic
1012630038 6:101454486-101454508 GTGACTTGAGACCGCTGAACTGG - Intronic
1012870886 6:104671345-104671367 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1012922423 6:105233876-105233898 TTGACTTCAGACCACTGTGCTGG + Intergenic
1013025031 6:106263111-106263133 TCGACTTTAGACTGCTGTGCTGG - Intronic
1013037987 6:106405150-106405172 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1013390233 6:109679223-109679245 GTCACTTCAGACTGCGGTGCTGG - Intronic
1013625673 6:111934840-111934862 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1013672619 6:112421648-112421670 TCGACTTAAGACTGCTGTGCTGG - Intergenic
1013682595 6:112541599-112541621 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1013920151 6:115394460-115394482 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1013939586 6:115645416-115645438 TCGACTTCAGACTGTTGTGCCGG - Intergenic
1013956911 6:115852568-115852590 TCGACTTCAGACTCCTTTGCTGG - Intergenic
1013972902 6:116042014-116042036 TAGACTTCAGACTGCTGTGCTGG - Intronic
1014058493 6:117043962-117043984 TTGAATTCAGACTGCCATGCTGG + Intergenic
1014223549 6:118822984-118823006 TCGACTTCAGAATGGTGTGCTGG + Intronic
1014278835 6:119418209-119418231 TAGACTTCAGACTGCTGTGCTGG - Intergenic
1014387070 6:120816067-120816089 TCAACTTCAGACTGCTATGCTGG + Intergenic
1014466322 6:121760760-121760782 TGGACTTCAGACTGCTGTGCTGG - Intergenic
1014569041 6:122986457-122986479 TAGACTTCAGACTGCTGTCCTGG - Intergenic
1014584599 6:123182706-123182728 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1014609179 6:123519684-123519706 TTGACTTTAGACTACTGCATAGG + Intronic
1014753695 6:125280505-125280527 TTGACTTCACACTGCTGTGCTGG - Intronic
1014836557 6:126166987-126167009 TTGACTTCAGAGTGCTGTGCTGG + Intergenic
1014872631 6:126614919-126614941 TTGACTTCAGCCTGCTGTGCTGG + Intergenic
1014968163 6:127782171-127782193 TCAACTTTAGACTGCTGTGCTGG + Intronic
1015108906 6:129569246-129569268 TCGACTTCAGACTGCTGTTCTGG - Intergenic
1015163023 6:130174050-130174072 TCAACTTCAGACTGCTGTGCTGG + Intronic
1015195049 6:130516556-130516578 TTGAGTTCAGACTGCTAGACTGG - Intergenic
1015211314 6:130701886-130701908 TTGACTTCAGACTGCCGTCCTGG - Intergenic
1015291075 6:131538829-131538851 TCGACCTCAGACTGCTATGCTGG - Intergenic
1015433224 6:133154938-133154960 TCGACTTCAGACTTCTGGGCTGG + Intergenic
1015471868 6:133614878-133614900 TCGCATTCAGACTGCTGTGCTGG - Intergenic
1015500760 6:133930953-133930975 TCGAATTCAGACTGCTGTGCTGG - Intergenic
1015623401 6:135156209-135156231 TCAATTTCAGACTGCTGTGCTGG + Intergenic
1015802072 6:137070400-137070422 TTGCCTTGAGACTGCTGTGGTGG - Intergenic
1015883287 6:137891266-137891288 TTGACTTCAGACTGCTGGGCTGG + Intergenic
1016241864 6:141940363-141940385 TTGACTTCAGATTGCTGTGCTGG - Intergenic
1016483493 6:144508111-144508133 TCGACTTCAGACTGCTGTCCTGG + Intronic
1016542161 6:145178215-145178237 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1016578432 6:145599010-145599032 CTGACTTCAGACTGTACTACAGG - Intronic
1016638714 6:146324266-146324288 TCAACTTCAGACTGCTGTGCTGG + Intronic
1016691545 6:146943483-146943505 TTGACTTCAGACTTCCATGCTGG + Intergenic
1016856026 6:148671434-148671456 TCGACCTCAGACTGCTGTGCTGG + Intergenic
1017295883 6:152793365-152793387 TTGGCTTCAGACTTCTGCACTGG - Intergenic
1017571408 6:155748859-155748881 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1017968704 6:159290408-159290430 TTGGCCTCAGACTGCTGTGCTGG + Intergenic
1018094526 6:160373881-160373903 TCGATTTCAGACTGCTGTGCCGG + Intronic
1018108715 6:160513955-160513977 TCAACCTCAGACTGCTGTGCTGG - Intergenic
1018114638 6:160571748-160571770 TCAACTTCAGACTGCTGTGCTGG + Intronic
1018507835 6:164490830-164490852 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1018805785 6:167258547-167258569 TCAACTTCAGATTGCTGTGCTGG - Intergenic
1019203678 6:170341369-170341391 TCGACTTCAGACTGCTGTGCTGG + Intronic
1019208385 6:170382713-170382735 TTCCCTCCAGACTGATGTACAGG + Intronic
1019851104 7:3558408-3558430 TTTCCTTCAGACTGCAGGACTGG - Intronic
1020358283 7:7301180-7301202 TTGACTTCAGACTTCTGTGCTGG + Intergenic
1020367234 7:7393802-7393824 TCAACTTCAGACTGCTGTGCTGG + Intronic
1020487669 7:8738999-8739021 TCGACTTCAGACTGCTGTGCTGG + Intronic
1020557689 7:9691057-9691079 CTGACTCCAGACTGCTGTGCTGG - Intergenic
1020608603 7:10367610-10367632 TTGACTTCAGACTGTTGCACTGG + Intergenic
1020629738 7:10625634-10625656 TTGACTTCAGACTGCTATGCTGG - Intergenic
1020639893 7:10742187-10742209 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1020693820 7:11391466-11391488 TCAACCTCAGACTGCTGTGCTGG + Intronic
1020694039 7:11392649-11392671 TCATCTTCAGACTGCTGTGCTGG - Intronic
1020716052 7:11675531-11675553 TCAGCTTCAGACTGCTGTGCTGG - Intronic
1020753423 7:12170731-12170753 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1020823848 7:13002837-13002859 TTGACTTCAGACTGCTGTACTGG + Intergenic
1020884352 7:13803673-13803695 TTGACTTCAGATCGCTGTGCCGG - Intergenic
1021014660 7:15517938-15517960 TCAACTTCAGACTACTGTGCTGG - Intronic
1021099518 7:16571962-16571984 TCGACTTCAGACTGTTGTGCTGG - Intronic
1021167017 7:17354317-17354339 TCGACTTCAGACTGCTATGCTGG + Intergenic
1021207849 7:17807224-17807246 TGGACTTCATACTGCTGTGCTGG - Intronic
1021307184 7:19046111-19046133 TTGATCTCAGACTGCTGCGCTGG - Intronic
1021322311 7:19227168-19227190 TTGACTTCAGACTGCTGTACTGG - Intergenic
1021347674 7:19548114-19548136 TCGACTTTGGACTGCTGTGCTGG + Intergenic
1021502389 7:21345589-21345611 TTGATTTCAGACTGCTGTGCTGG - Intergenic
1021749353 7:23779710-23779732 TTGACTTCAGACTGCCATGCTGG + Intronic
1021916307 7:25436578-25436600 TTAAGTTCATACTGATGTACTGG + Intergenic
1022058856 7:26770328-26770350 TCAACTTCAGACTGCTACACTGG + Intronic
1022475642 7:30707802-30707824 TTGACTTCAGAGTGCTCTCCTGG + Intronic
1022615621 7:31927078-31927100 TCAACTTCAGATTGCTGTGCTGG - Intronic
1022848466 7:34235508-34235530 TTGACTTCAGACTACTGTGCTGG + Intergenic
1023051759 7:36258696-36258718 TCGACTTCAGACTGCTGTGCTGG + Intronic
1023511631 7:40959541-40959563 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1023697772 7:42865303-42865325 TAGACTTCAGACTGCTGTGCTGG + Intergenic
1024017714 7:45333099-45333121 TCGGCTTCAGACTTCTGTGCTGG - Intergenic
1024495440 7:50040924-50040946 TCGACCTCAGACAGCTGTGCTGG - Intronic
1024664912 7:51536636-51536658 GTGACTTCAGACTGCTGTGCTGG + Intergenic
1024950516 7:54855900-54855922 TCGATTTCAGACTGCTGTGCTGG + Intergenic
1024998531 7:55294787-55294809 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1025621397 7:63174871-63174893 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1025637936 7:63340000-63340022 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1025644761 7:63408099-63408121 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1025714391 7:63941514-63941536 TTGACTTCAGACTGCTGTACTGG - Intergenic
1027572524 7:79888415-79888437 TTGCCTACAGTGTGCTGTACAGG + Intergenic
1027637077 7:80689309-80689331 TCAACTTCAGACTGCTATGCTGG - Intergenic
1027864578 7:83629662-83629684 TCACCTTCAGACTGCTGTGCTGG + Intronic
1027982966 7:85250241-85250263 TTGATCTCAGACTGCTGTGCTGG - Intergenic
1028142373 7:87288282-87288304 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1028144293 7:87304623-87304645 TAGACTGCAGACTGCTGTACTGG - Intergenic
1028327016 7:89540227-89540249 TCCACTTCAGACTGTTGTGCTGG - Intergenic
1028378110 7:90168403-90168425 TCGAGTTCAGACTGCTCTGCTGG - Intronic
1028476338 7:91257749-91257771 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1028627971 7:92898588-92898610 TTGACTTCAGACTGTTGTGTTGG + Intergenic
1028652850 7:93170284-93170306 TTGACCTCAGACTGTTGTGCTGG + Intergenic
1028801410 7:94970021-94970043 TCGACTTCATACTGCTGTGCTGG + Intronic
1028806045 7:95026957-95026979 TCGACTTCAGACTGCTGTGCTGG + Intronic
1028991249 7:97051176-97051198 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1029312482 7:99679987-99680009 TTGGCTGAAGACTGCTGTGCAGG - Exonic
1029314620 7:99700125-99700147 TTGACCTAAGACTGCTGTGCAGG - Intronic
1029320265 7:99752582-99752604 TTGTCCTAAGACTGCTGTGCAGG - Intergenic
1029845261 7:103406052-103406074 TTGACTTCAGACTGCTGTGGTGG + Intronic
1029851113 7:103462619-103462641 TTGACCTCAGACTGTTGTGCTGG + Intergenic
1029854831 7:103504844-103504866 TCGACCTCAGACTGCTGTGTTGG - Intronic
1030141037 7:106304340-106304362 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1030159536 7:106493139-106493161 TTGACTTCAGACTGCTGGGCTGG - Intergenic
1030325851 7:108217792-108217814 TCGACTTCAGACTGCAGTGTTGG + Intronic
1030482298 7:110119958-110119980 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1030500822 7:110356656-110356678 TCCACTTCAGACTGCCGTGCTGG + Intergenic
1030612638 7:111706090-111706112 TGAAATTCAGACTGCTGTGCTGG - Intergenic
1030705637 7:112690037-112690059 TCAACTTCAGACTGCTCTGCTGG + Intergenic
1030771111 7:113475784-113475806 TCAACTTCAGACTACTGTGCTGG + Intergenic
1030801335 7:113856536-113856558 TTGACTTCAGACTGTTGTGCTGG - Intergenic
1030958848 7:115889416-115889438 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1031031833 7:116743494-116743516 TCAACTTCAGACTGCTGTGCTGG - Intronic
1031397744 7:121293379-121293401 TCGACTTCAGACTGCAGTGTTGG + Intronic
1031469992 7:122157372-122157394 TGGACCTCAGACTTCTGTCCTGG - Intergenic
1031613776 7:123857058-123857080 TTGACTTCAGATTGCTGTGCTGG + Intronic
1031710998 7:125046568-125046590 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1031717299 7:125125092-125125114 TCAATTTCAGACTGCTGTGCTGG + Intergenic
1032295935 7:130638601-130638623 TCAACTTCAGACTGCTGTGCTGG + Intronic
1032312587 7:130802399-130802421 TCCACCTCAGACTGCTGTGCTGG + Intergenic
1032367707 7:131315665-131315687 TTGACTTCAGACTGGTGTGCTGG - Intronic
1032659757 7:133970218-133970240 TCGACTTCAGACTGCTATGCTGG + Intronic
1032893312 7:136222749-136222771 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1032957124 7:136984313-136984335 TGGACTTCAGACTGCTGTGCTGG + Intronic
1032966444 7:137103656-137103678 TCGACTTCAAACTGCTATGCTGG - Intergenic
1033525608 7:142210455-142210477 TCAACTTCAGACAGCTGTGCTGG - Intronic
1033617652 7:143032281-143032303 TCAACTTCAGGCTGCTGTGCTGG - Intergenic
1033680042 7:143584663-143584685 TGGAGCTCAGACTGCTGTGCTGG - Intergenic
1033691792 7:143744779-143744801 TAGAGCTCAGACTGCTGTGCTGG + Intergenic
1033835719 7:145309361-145309383 TTGACTTCAAACTATTCTACAGG + Intergenic
1034370780 7:150594616-150594638 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1034460374 7:151194719-151194741 TTGACCACAGAATGTTGTACAGG - Intronic
1034735609 7:153426506-153426528 TTGATTCCAGACTGCTGGAGGGG - Intergenic
1034792414 7:153983420-153983442 TCAACTTCAGACGGCTGTGCTGG + Intronic
1035998317 8:4573996-4574018 TCGACTTCAGACTGCTGTGCTGG + Intronic
1036062270 8:5336987-5337009 TTGACTACAGTCTGCTGCACAGG + Intergenic
1036769517 8:11569270-11569292 TTTGCTTAAGACTGCTCTACTGG - Intergenic
1037285480 8:17294326-17294348 TCGACCTCAGACTGCTATGCTGG + Intronic
1037719646 8:21431621-21431643 TCAACTTCAGTCTGCTGTGCTGG - Intergenic
1038211570 8:25523308-25523330 TTGACTTCGGACTGCTGTGCTGG - Intergenic
1038921132 8:32085831-32085853 ATGACTTCAGACTTCTGGCCTGG - Intronic
1038936454 8:32257158-32257180 TGGACTTCAGACTGCTATGCTGG + Intronic
1039133844 8:34297839-34297861 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1040520100 8:48169241-48169263 TTGACTTCAGACTACTGTGCTGG + Intergenic
1040736553 8:50515569-50515591 TCAACTTCAGACTGCTGTTCTGG - Intronic
1040943046 8:52852533-52852555 TTGACCTCAGACTGCTATGCTGG + Intergenic
1040968811 8:53112356-53112378 TTGACCTCAGACTGCTGTGCTGG + Intergenic
1041155056 8:54977154-54977176 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1041419088 8:57646867-57646889 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1041459745 8:58098417-58098439 TGGACTTCAGACTGCTGTGCTGG + Intronic
1041481972 8:58332005-58332027 CTGACTCCAGACTGCTGCGCTGG - Intergenic
1041583961 8:59494962-59494984 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1041630577 8:60082808-60082830 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1041836634 8:62223690-62223712 TTGACTTCTGACTGCTGCACTGG - Intergenic
1041838339 8:62242109-62242131 TGGACTTCAGACTGCTGTGATGG + Intergenic
1041900634 8:62978589-62978611 TCTACTTCAGACTGCTGTGCTGG + Exonic
1042110920 8:65380203-65380225 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1042327169 8:67540877-67540899 TTGACTTCAGACTGCTGTGCTGG + Intronic
1042478805 8:69280465-69280487 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1042612497 8:70614311-70614333 ATGTCTGCAGACTGCAGTACTGG + Intronic
1042622721 8:70724255-70724277 TCGACTTCAGACTGCTATGCTGG + Intronic
1042753495 8:72184484-72184506 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1042812917 8:72845813-72845835 TAGACTTCAGACTGCTGTGCTGG + Intronic
1042969312 8:74391052-74391074 TTGACTTTAGACTGCTGTGCTGG + Intronic
1042969327 8:74391156-74391178 CTGACTTCAGCCCGCTTTACAGG + Intronic
1043036675 8:75208196-75208218 CTGACTTCAGACTGCTGTGCTGG + Intergenic
1043118152 8:76286427-76286449 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1043253672 8:78106466-78106488 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1043366323 8:79537313-79537335 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1043368273 8:79560526-79560548 TTGACTTCAGATTGCTGTGTTGG + Intergenic
1043532424 8:81165921-81165943 TGGATTTCAGACTGCTGTGCTGG - Intergenic
1043647249 8:82536240-82536262 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1043703611 8:83322052-83322074 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1044131093 8:88525450-88525472 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1044242914 8:89907662-89907684 CTGACTTCAGACTATTCTACAGG - Intronic
1044267718 8:90203445-90203467 TCGACTTTAAACTGCTGTGCTGG - Intergenic
1044312382 8:90708909-90708931 TCGACTTCAGACAGCTGTGCTGG + Intronic
1044405263 8:91819010-91819032 GTCACTTCAGACTGCTGTGTTGG - Intergenic
1044503557 8:92991019-92991041 TCAACTTCAGACTGCTGTGCTGG - Intronic
1044509476 8:93058337-93058359 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1044595263 8:93953143-93953165 TGGACTCCAGACTGCTGTGCTGG + Intergenic
1044940260 8:97335013-97335035 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1044961013 8:97530443-97530465 TCGTCTTCAGACTGCTGTGCTGG - Intergenic
1045014063 8:97983516-97983538 AGGACTTCAGTCTGCTGGACAGG + Intronic
1045151791 8:99416291-99416313 TTGACTTCAGACTGCTGTCCTGG + Intronic
1045185183 8:99830473-99830495 TCAACTTCAGACTGCTGTGCTGG + Intronic
1045199663 8:99967498-99967520 TTGACTTCAGACTTTTGTGCTGG - Intronic
1045772747 8:105763321-105763343 TTGATTTCAGACTGTTATTCTGG - Intronic
1045783677 8:105897240-105897262 TCGACTTCAGACCGCTGTGATGG - Intergenic
1045839341 8:106561242-106561264 TTGACTTCAGACTGTTTTGCTGG - Intronic
1045973333 8:108104050-108104072 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1045975100 8:108122899-108122921 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1046067989 8:109218883-109218905 GTGACTTCAGATTGCTGGGCTGG + Intergenic
1046106492 8:109672798-109672820 TTGACTTCAGACTGCTGTGCTGG - Intronic
1046153484 8:110257752-110257774 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1046277808 8:111985844-111985866 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1046295860 8:112218392-112218414 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1046947478 8:119987891-119987913 TCGACCTCTGACTGCTGTGCTGG + Intronic
1046972546 8:120238481-120238503 TTGACTTCACATTGCTGTGCTGG + Intronic
1047133675 8:122051637-122051659 TCAACTTCGGACTGCTGTGCTGG - Intergenic
1047369585 8:124245424-124245446 TCGACTTCAGAATGCTGTGCTGG + Intergenic
1048914122 8:139165547-139165569 TCGACCTCAGACTGCTGTGCTGG + Intergenic
1049036792 8:140082843-140082865 TTGACTTGGGACTGCTTTTCTGG + Intronic
1049118064 8:140707430-140707452 TTGAGTTGAGACTGCCGTATAGG + Intronic
1049872375 8:144990686-144990708 TTGACTCCAGACTACTGTGCTGG + Intergenic
1049964599 9:767012-767034 TGGACTTCAGACTGCTGTGCTGG - Intergenic
1050031762 9:1393643-1393665 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1050141556 9:2521379-2521401 CCAACTTCAGACTGCTGTGCTGG + Intergenic
1050234397 9:3562764-3562786 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1050239903 9:3624209-3624231 TCCACTTCAGACTGCTGTGCTGG + Intergenic
1050369035 9:4901958-4901980 TCAACTGCAGACTGCTGTGCTGG + Intergenic
1050404020 9:5288339-5288361 CTGACTTCAAACTGCACTACAGG - Intergenic
1050637403 9:7626771-7626793 TAGACTTCAGACTGCTGTGCTGG - Intergenic
1050750623 9:8932744-8932766 TTGACTTCAGACTGCTGTGCTGG + Intronic
1050963327 9:11765829-11765851 TTGACTTCAGAATGCTGTGCTGG - Intergenic
1050973917 9:11912284-11912306 TCAACTTCAGACTGCTGTGTTGG + Intergenic
1051124809 9:13791917-13791939 TTGATCTCAGACTGCTGCGCTGG - Intergenic
1051199427 9:14599720-14599742 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1051230462 9:14949997-14950019 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1051298123 9:15618392-15618414 TCGACTCCAGACTGCTGTGCTGG + Intronic
1051321948 9:15914520-15914542 TTGACTTCGGACTGCTGTGCTGG + Intronic
1051451744 9:17205059-17205081 TCGACTTCAGACTGCTGTGCTGG + Intronic
1051548722 9:18305473-18305495 TAGACTTCAGACTGCTGTGCTGG - Intergenic
1051571493 9:18563885-18563907 TCGACTTCAGACTGCTGTGCTGG + Intronic
1051611652 9:18967618-18967640 TCAACTTCAGACTGCTGTGCTGG + Intronic
1051674583 9:19546560-19546582 TTGACCTCAGACTGTTGTGCTGG + Intronic
1051695817 9:19767167-19767189 TCGACTTCAGACTGCTGTGCTGG + Intronic
1051814314 9:21087490-21087512 TTGACTTCAGACTGCTGTGGGGG - Intergenic
1051863391 9:21651724-21651746 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1051940226 9:22496323-22496345 TTGACTTTAGAATGCAGTGCTGG + Intergenic
1051982902 9:23045964-23045986 TAGACTCCAGACTGCTGTGCTGG - Intergenic
1051998460 9:23247998-23248020 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1052061554 9:23966525-23966547 GTGACTTCAGATTGCTGAGCTGG + Intergenic
1052096591 9:24391354-24391376 TTGGCTTCCGACTGCTGTACTGG + Intergenic
1052144054 9:25025755-25025777 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1052146902 9:25061183-25061205 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1052281221 9:26735444-26735466 TTGACTGCAGACTGCTGTGCTGG + Intergenic
1052292735 9:26862688-26862710 CTGACCTGAGACTGCTGAACTGG + Intronic
1052336395 9:27324486-27324508 TCAACCTCAGACTGCTGTGCTGG + Intergenic
1052366202 9:27614807-27614829 TGGACCTCAGACTGCTGTGCTGG + Intergenic
1052382338 9:27785071-27785093 ATGACTTCAGACTGCTGTGCTGG + Intergenic
1052506356 9:29359208-29359230 TTGACTTCAGACTGCTGTTCTGG - Intergenic
1052628316 9:31005003-31005025 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1052668016 9:31519252-31519274 TTGACTTCAGACTGCTAAGCTGG + Intergenic
1053608166 9:39681264-39681286 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1053751716 9:41263749-41263771 TTAATCTCAGACTGCTGCACTGG + Intergenic
1053866008 9:42437624-42437646 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1054245365 9:62661145-62661167 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1054257243 9:62828078-62828100 TTAATCTCAGACTGCTGCACTGG + Intergenic
1054559493 9:66695676-66695698 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1054719886 9:68594020-68594042 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1054985996 9:71262389-71262411 TCAACTTCAGACTGCTGTGCTGG + Intronic
1055061425 9:72072765-72072787 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1055210313 9:73783316-73783338 TCAGCTTCAGACTGCTGTGCTGG - Intergenic
1055239222 9:74163762-74163784 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1055338977 9:75261826-75261848 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1055345051 9:75327020-75327042 TCTACTTCAGATTGCTGTGCTGG + Intergenic
1055386842 9:75771814-75771836 TCGACCTCAGACTGCTGTGCTGG + Intergenic
1055390947 9:75821617-75821639 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1055494574 9:76841583-76841605 TTGACTTCAGACTGCTGTGCTGG - Intronic
1055537882 9:77268034-77268056 TTGACTTCAGACTGCTGTGCTGG + Intronic
1055628753 9:78201215-78201237 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1055823898 9:80301152-80301174 TCAACTTCAGACTACTGTGCTGG + Intergenic
1056000977 9:82216159-82216181 TCTACTTCAGACTGCTGTGCTGG - Intergenic
1056003535 9:82242875-82242897 TTGAATTCAGACTGCTGTGCTGG + Intergenic
1056073794 9:83017005-83017027 TTGACTTCATCCAGCTTTACAGG + Intronic
1056123734 9:83514229-83514251 TCAACTTCAGACTGCTGTGCTGG - Intronic
1056176789 9:84043938-84043960 TTGACTTCAGACTGCTATGTTGG + Intergenic
1056302638 9:85258022-85258044 TCAACTTCAGACTGCTGTGTTGG + Intergenic
1056385149 9:86090611-86090633 GCAACTTCAGACTGCTGTGCTGG + Intronic
1056774205 9:89499102-89499124 TGGACTACAGACTGCTGTTGAGG + Intergenic
1056997778 9:91479519-91479541 TCAACTTCAGACTGCTGTCCTGG + Intergenic
1057460313 9:95254844-95254866 TTGACTTCAGACTGCTGTGCTGG - Intronic
1058029266 9:100177392-100177414 TCGACTTCAGACTGCTGTGATGG - Intronic
1058034588 9:100237231-100237253 TTGACTTCAGACTGCTGTGCTGG + Intronic
1058408462 9:104703727-104703749 TCGACTTGAGACTGCTGTACTGG - Intergenic
1062297602 9:135841115-135841137 TCGACTTCAGACTACTGTGCTGG - Intronic
1203460037 Un_GL000220v1:26282-26304 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1186370020 X:8937265-8937287 TCTACTTCAGACTGCTATACTGG + Intergenic
1186460633 X:9745782-9745804 TTGACTTTTCACTTCTGTACTGG - Intronic
1186599810 X:11024667-11024689 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1186773315 X:12839231-12839253 TCAACTTCAGACTGCTGCGCTGG + Intergenic
1186774860 X:12854639-12854661 TCCATTTCAGACTGCTGTGCCGG + Intergenic
1186774984 X:12855388-12855410 TTGAATTCAGACAGCTATATGGG + Intergenic
1186810333 X:13181878-13181900 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1186832501 X:13404536-13404558 CCAACTTCAGACTGCTGTGCTGG - Intergenic
1186960954 X:14736108-14736130 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1187660847 X:21545153-21545175 TCCACTTCAGACTGCCGTGCTGG - Intronic
1187784311 X:22866947-22866969 TGGACTTCAGACTGCTATGCTGG - Intergenic
1188130022 X:26419638-26419660 TCGACTTCAGATTGCTATGCTGG + Intergenic
1188193212 X:27197252-27197274 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1188201688 X:27299788-27299810 TTGACTTCAGACTGCTGTACTGG - Intergenic
1188561244 X:31471023-31471045 TCCACTTCAGACTGCTGTGCTGG + Intronic
1188664633 X:32804243-32804265 TCCACTTCAGACTGCTGTGCTGG - Intronic
1188893296 X:35636236-35636258 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1188915463 X:35904751-35904773 TTGACTCCAGACTGCTGTGCTGG + Intergenic
1188921927 X:35987482-35987504 TCAACTTCATACTGCTGTGCTGG + Intronic
1189189631 X:39089072-39089094 TCGATTTCAGACTGCTGTCCTGG - Intergenic
1189210813 X:39280577-39280599 TGGACTTCAGACTGCTGTGCTGG + Intergenic
1189575110 X:42343244-42343266 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1189590640 X:42507298-42507320 TAAACTTCAGACTGCTGTGCTGG - Intergenic
1189754129 X:44253389-44253411 TCGACTTCAGACTGCTGTGCTGG - Intronic
1190341468 X:49299884-49299906 TCAACTTCAGACTGCTGTGCTGG + Intronic
1190495090 X:51020936-51020958 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1190505873 X:51125493-51125515 TTGATTTCAGACTGCTGTGCTGG - Intergenic
1190621567 X:52292172-52292194 TTGATCTCAGACTGCTGTGCTGG - Intergenic
1190943978 X:55072940-55072962 TAGACATCAGACTGCTGGGCTGG + Intergenic
1190946138 X:55095774-55095796 TCGACTTCAGCCTGCTGTGCTGG + Intronic
1190959769 X:55234693-55234715 TCGACTTCAGACTGCTGTGCTGG + Intronic
1190966422 X:55305591-55305613 TCGACTTCATACTGCTGTGCTGG + Intergenic
1190995691 X:55606366-55606388 TAGACTTCAGACTGCTGTGATGG + Intergenic
1191005076 X:55702690-55702712 TTGACCTCAGACTGCTGAACTGG - Intergenic
1191024269 X:55896660-55896682 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1191048260 X:56162507-56162529 TTGATCTCAGACTGCTGTGCTGG + Intergenic
1191072029 X:56410897-56410919 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1191088719 X:56597539-56597561 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1191094353 X:56659025-56659047 TCAACTTCAGACTGCTCTGCTGG + Intergenic
1191097435 X:56688485-56688507 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1191098979 X:56704805-56704827 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1191113945 X:56832458-56832480 TTGACATTAGACTGCTGTGCTGG + Intergenic
1191132631 X:57030894-57030916 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1191133293 X:57037907-57037929 TTGACTTCAGACTGCTGTGTTGG + Intergenic
1191135413 X:57058796-57058818 TTGACTTCAGGCTGCTGTGCTGG + Intergenic
1191148113 X:57190270-57190292 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1191153248 X:57243019-57243041 TTGACTTCATACTGCTGTGCTGG - Intergenic
1191172150 X:57459096-57459118 TTGACTTCAGAGTACTGTGCTGG - Intronic
1191174171 X:57482111-57482133 TTAACCTCAGACTGTTGTGCTGG + Intronic
1191186678 X:57620758-57620780 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1191204076 X:57816187-57816209 TTGACCTTGGACTGCTGTGCTGG + Intergenic
1191206709 X:57842349-57842371 TTGACTTCAGTCTGCTCTGCTGG - Intergenic
1191237890 X:58150920-58150942 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1191601779 X:63016781-63016803 TGGACTTCAGACTGCTGTGCTGG + Intergenic
1191631944 X:63331294-63331316 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1191657442 X:63613735-63613757 TTGACTACAGACAGCTGTGCTGG - Intergenic
1191686738 X:63899714-63899736 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1191705119 X:64085954-64085976 TGGACCTCATACTGCTGTGCTGG - Intergenic
1191788773 X:64945953-64945975 TCAACTTCAGACTGCTGTGCTGG + Intronic
1191793771 X:64999707-64999729 TCGACTTCAGACTGCTGTGCTGG - Intronic
1191795651 X:65018801-65018823 TCGACCTTAGACTGCTGTACTGG - Intronic
1191799928 X:65067013-65067035 TCGACTTCAGACTGCTATGCTGG + Intergenic
1191809998 X:65176156-65176178 TTGACTTCAGACTGCTGTCCTGG - Intergenic
1191824841 X:65353730-65353752 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1191848601 X:65569195-65569217 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1191872945 X:65765253-65765275 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1191908949 X:66127094-66127116 TCAACTCCAGACTGCTGTCCTGG + Intergenic
1191928702 X:66344537-66344559 TTGGCTTCAGACTGCTGTGCTGG + Intergenic
1191931358 X:66376492-66376514 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1191962484 X:66718868-66718890 TAGACTTCAGACTGCTGTGCTGG - Intergenic
1191969663 X:66799298-66799320 TCGACTGCTGACTGCTGTGCTGG - Intergenic
1192018457 X:67357999-67358021 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1192030700 X:67509456-67509478 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1192064281 X:67864610-67864632 TCAACTTCAGACTGCTGCACTGG + Intergenic
1192128979 X:68530339-68530361 TCCACTTCAGACTGCTGTGCTGG + Intronic
1192228460 X:69246175-69246197 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1192524544 X:71830232-71830254 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1192598548 X:72437608-72437630 TCATCTTCAGACTGCTGTGCTGG - Intronic
1192662134 X:73052639-73052661 TCGTCTTCAGACTGCTGTGTTGG - Intergenic
1192692120 X:73374952-73374974 TCGACTTCAGACTGCTGTGTTGG - Intergenic
1192701788 X:73482198-73482220 TTGACTTCAGACTGCTGGGTTGG + Intergenic
1192707404 X:73541155-73541177 TTGGCTTCAGACTGCTATGCTGG - Intergenic
1192712614 X:73607355-73607377 TTGACTTCAGACTGCTGTGCTGG + Intronic
1192759195 X:74077926-74077948 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1192878586 X:75258389-75258411 TCAACCTCAGACTACTGTACTGG - Intergenic
1192884271 X:75320425-75320447 TTGAGTTCAGATTGCTGTGCTGG + Intergenic
1192922751 X:75724471-75724493 TGGACTTCAGACTGCTGTCCTGG + Intergenic
1192933967 X:75839134-75839156 TCGACTTCAGACTGCTGTACTGG + Intergenic
1192938021 X:75881523-75881545 TTGACTTCAGACTGCTCTGCTGG + Intergenic
1192953180 X:76039488-76039510 TCAACTTCAGACTACTGTGCTGG + Intergenic
1192958175 X:76095719-76095741 TTTACTTCAGACTGCCGTGCTGG + Intergenic
1192966553 X:76183153-76183175 TGGACTTCAGACTGCTGTGCTGG + Intergenic
1192971298 X:76233912-76233934 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1192974980 X:76273563-76273585 TCGACCTCAGACTGCTGTTCTGG + Intergenic
1192984281 X:76379972-76379994 TTGACTTCAGGCTGCTGTGCTGG - Intergenic
1192994017 X:76492939-76492961 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1192998035 X:76533291-76533313 TCAACTCCAGACTGCTGTGCTGG + Intergenic
1192999620 X:76550318-76550340 TTGACTTCAGACACCTGTGCTGG + Intergenic
1193034474 X:76934493-76934515 TTGACTTCAGACTGTTGTGCTGG - Intergenic
1193040466 X:76998852-76998874 TCAAGTTCAGACTGCTGTGCTGG + Intergenic
1193055315 X:77143655-77143677 TTGACTCCCGACTGCTGTACTGG - Intergenic
1193065482 X:77254897-77254919 TCGACTTCAGACTACTGTGCGGG - Intergenic
1193068587 X:77283095-77283117 TTCACCTCAGTCTGCTGTGCTGG - Intergenic
1193075184 X:77347752-77347774 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1193081591 X:77411913-77411935 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1193228430 X:79013303-79013325 TCAACTTCAGACTGCTGCACTGG + Intergenic
1193254032 X:79325537-79325559 TTGACTTCAGGCTGCTGTGCTGG + Intergenic
1193266845 X:79482281-79482303 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1193284626 X:79697158-79697180 TTGACTTCAGGCCACTGTGCTGG + Intergenic
1193334642 X:80273996-80274018 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1193341313 X:80352533-80352555 TGGACTTCAGACTGCTTTGCTGG + Intronic
1193350840 X:80462749-80462771 TTGACTTCAGAATGCTGTGCTGG - Intergenic
1193355995 X:80521069-80521091 TCAACCTCAGACTGCTGTGCTGG + Intergenic
1193361702 X:80586748-80586770 TTGACTTCAGACCGCTGTGCTGG + Intergenic
1193382178 X:80828060-80828082 CAGACTTCAGACTGCTGTGCTGG + Intergenic
1193398569 X:81014438-81014460 TGGAGTTCAGACTGCTGTGCTGG - Intergenic
1193404474 X:81084189-81084211 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1193514384 X:82445864-82445886 TCAACTTCAGACTGCTACACTGG - Intergenic
1193525292 X:82581208-82581230 TGGACTTCAGACTGCTGTGCTGG + Intergenic
1193547968 X:82852660-82852682 TTGACTTCAGACTACTTTACTGG + Intergenic
1193562661 X:83038058-83038080 TGGACTCCAGACTGCTGTGCTGG - Intergenic
1193571665 X:83151938-83151960 TCGACTTCCGACTGCTGTGCTGG - Intergenic
1193616002 X:83688766-83688788 TGGACTTCAGACTGCTGTGCTGG + Intergenic
1193645695 X:84066376-84066398 TTGACTTCAGACTGCTGTGTTGG - Intronic
1193646768 X:84079592-84079614 TTGACTTCAGACTGCTGTGCTGG - Intronic
1193685425 X:84571748-84571770 TGGACTTCAGACTGCTGTGCTGG - Intergenic
1193830003 X:86278809-86278831 TCGATTTCAGACTGCTGTGCTGG - Intronic
1193878730 X:86896120-86896142 TTGACTTCAGACTGTTGTGCTGG - Intergenic
1193897265 X:87128872-87128894 TTGACTTCAGACTGATGTGCTGG - Intergenic
1193906752 X:87253793-87253815 TCAACCTCAGACTGCTGTGCTGG + Intergenic
1193949324 X:87778678-87778700 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1194021252 X:88694781-88694803 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1194098580 X:89674383-89674405 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1194139858 X:90196226-90196248 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1194203513 X:90983574-90983596 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1194242559 X:91470047-91470069 TCGACTTCAGACTACTGTGCTGG - Intergenic
1194315294 X:92369386-92369408 TCAACTTCAGACTGCTGTGCTGG + Intronic
1194347008 X:92778124-92778146 TTGACTTCAAACTGTACTACAGG + Intergenic
1194355781 X:92882239-92882261 TGGACTTCAGACTGCTGTGCAGG - Intergenic
1194391166 X:93319701-93319723 TCGAGCTCAGACTGCTGTGCTGG - Intergenic
1194419921 X:93660975-93660997 TAGACTTTAGACTGCTGTGCTGG - Intergenic
1194515331 X:94845065-94845087 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1194545144 X:95225233-95225255 TGAATTTCAGACTGCTGTGCTGG - Intergenic
1194559541 X:95403666-95403688 TTGACTTTAGACTGCTTTGCTGG - Intergenic
1194576356 X:95618793-95618815 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1194582040 X:95685822-95685844 TTGACTTCATACTTCTCTACTGG + Intergenic
1194624776 X:96214795-96214817 TTGACTTTAGACTGCTGTGCTGG - Intergenic
1194783130 X:98049229-98049251 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1194798398 X:98240712-98240734 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1194837477 X:98698985-98699007 TTGACTTCAGACTTCTGTGCTGG + Intergenic
1194901199 X:99514182-99514204 TCCACTTCAGACTGCTGTGCTGG - Intergenic
1194954419 X:100162448-100162470 CTGACTTCAGACTGCCGTACTGG + Intergenic
1194959072 X:100214646-100214668 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1194961048 X:100236337-100236359 TCAATTTCAGACTGCTGTGCTGG + Intergenic
1194964003 X:100267095-100267117 TCGACTTCAGACTGCTTTGCTGG - Intergenic
1194984268 X:100473205-100473227 TTGACTTCAAACTATAGTACAGG + Intergenic
1195127441 X:101822401-101822423 TCGACTTGAGACTGATGTGCTGG + Intergenic
1195140097 X:101950449-101950471 TTAACTTCAGACTGCTGTACTGG - Intergenic
1195147474 X:102031835-102031857 TTGATCTCATACTGCTGTGCTGG - Intergenic
1195233023 X:102870054-102870076 TGGACTTCAGACTGCTATGCTGG + Intergenic
1195434696 X:104829002-104829024 TCAACTTCAGACTGCTGTGCTGG + Intronic
1195435920 X:104843278-104843300 TCGACTCCAGACTTCTGCACTGG + Intronic
1195469033 X:105212231-105212253 TTGACTTCAGACTGCTGTGCTGG - Intronic
1195519254 X:105812324-105812346 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1195810635 X:108825089-108825111 TCAACCTCAGACTGCTGTGCTGG + Intergenic
1195820878 X:108944253-108944275 TTGACTTCAGACTGCTGCGCTGG + Intergenic
1195833735 X:109089133-109089155 TAGACTTCAGACTGCTGTGCTGG + Intergenic
1195844246 X:109209164-109209186 TCGACTTCAGACTGCTGTACTGG + Intergenic
1195985570 X:110626583-110626605 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1196133395 X:112181447-112181469 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1196273168 X:113735873-113735895 TTGACTTCAGACTTCTATACTGG + Intergenic
1196281179 X:113825389-113825411 TTGGCTTCAGATGGCTGTGCTGG + Intergenic
1196312377 X:114183749-114183771 TTGACTTCAGACTGCGGTCCTGG - Intergenic
1196367818 X:114943086-114943108 TCAACTTCAGACTGCTGTGTTGG + Intergenic
1196467048 X:115983252-115983274 TCAACTTCAGACTGCTTTGCTGG - Intergenic
1196473241 X:116052519-116052541 TTGATCTCAGACTGCTGTGCTGG + Intergenic
1196545728 X:116962450-116962472 TCAACCTCAGACTGCTGTGCTGG + Intergenic
1196602950 X:117622960-117622982 TCGACTTCAGACTGCTATGCTGG + Intergenic
1196946598 X:120832936-120832958 TCCACTTCAGACTGCTGTGCTGG + Intergenic
1196960219 X:120992924-120992946 TCCACTTCAGACTGCTGTGCTGG + Intergenic
1197051187 X:122061300-122061322 TCGACTTCAGACTCCTGTGCTGG - Intergenic
1197142193 X:123129911-123129933 TTGACTTCAGAGTGCTGTGCTGG - Intergenic
1197157219 X:123283512-123283534 TCGACTTCAGAGTGCTGTGCTGG - Intronic
1197191091 X:123648580-123648602 TCGACTTCAGACTGCTGTGCTGG - Intronic
1197350135 X:125372623-125372645 TCAACTTCAGACTGCTGTGCTGG + Intergenic
1197880756 X:131164284-131164306 TCAACTTCAGACTGCTGTACTGG + Intergenic
1197906242 X:131428531-131428553 TCGACTTCAGACTGCTGTGGTGG - Intergenic
1197926930 X:131656500-131656522 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1198060571 X:133042082-133042104 TTGACTTCAGACTGCTGTGCTGG + Intronic
1198062594 X:133062030-133062052 TCGACTTCAGACTGCTGTGCTGG - Intronic
1198295393 X:135282364-135282386 TCGACTTCAGACTGCTGTGCTGG + Intronic
1198518990 X:137433644-137433666 TCCACTTCAGACTACTGTGCTGG - Intergenic
1198645501 X:138801954-138801976 TGGACTTCAGACTGCTGCGCTGG + Intronic
1198753534 X:139959183-139959205 TCTACTTCAGACTGCTGTGCTGG - Intronic
1198758013 X:140001166-140001188 TCTACTTCAGACTGCTGTGCTGG - Intergenic
1198784483 X:140272772-140272794 TCGACTTCAGACTGTTGTGCTGG + Intergenic
1199004122 X:142675243-142675265 TTGACTTCAGACTGCTGTGCTGG + Intergenic
1199012183 X:142770648-142770670 TCGACTTCAGACTGCTGTGCTGG + Intergenic
1199094466 X:143723743-143723765 TCGACTTCAAACTGCTGTGCTGG - Intergenic
1199401616 X:147405531-147405553 CTGACTCCAGACTGCTGTGCTGG - Intergenic
1199436599 X:147819640-147819662 TAGACTTCAGACTGCTTTGTTGG - Intergenic
1199452215 X:147989873-147989895 TCGACTTCAGACTGCTGTGCTGG + Intronic
1199469822 X:148181915-148181937 TTGACTTCAGACTGTTGTGCTGG + Intergenic
1199477366 X:148260278-148260300 TCCACTTCAGACTGCTTTGCTGG + Intergenic
1199524896 X:148781570-148781592 TCGACTTCAGACTGCTGTGCTGG + Intronic
1199857116 X:151768421-151768443 CTGGCTTCTTACTGCTGTACTGG + Intergenic
1200333221 X:155319826-155319848 TCGACTTCAGACTGCTGTGCTGG - Intronic
1200388498 X:155918181-155918203 TCGACTTCAGACTGTTGTGCTGG + Intronic
1200451602 Y:3335758-3335780 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1200485605 Y:3765195-3765217 TCGACTTCAGACTGCTGTGCTGG - Intergenic
1200549344 Y:4559013-4559035 TCAACTTCAGACTGCTGTGCTGG - Intergenic
1200623344 Y:5480921-5480943 TCAACTTCAGACTGCTGTGCTGG + Intronic
1200655336 Y:5894764-5894786 TTGACTTCAAACTGTACTACAGG + Intergenic
1200664127 Y:5999220-5999242 TGGACTTCAGACTGCTGTGCAGG - Intergenic
1200740281 Y:6846704-6846726 TCGACTTCACACTGCTGTGCTGG + Intergenic
1201371479 Y:13269380-13269402 TTTACTTCAGACTGCTGTGCTGG + Intronic
1201376723 Y:13330765-13330787 TTGACTTAAGACTGCTGTGCTGG - Intronic
1201490868 Y:14540058-14540080 TTGACCTAAGACTGCTGTGCTGG - Intronic
1201511539 Y:14769816-14769838 TTGGCTTCAGGCTTCTGTGCTGG - Intronic
1201519616 Y:14859253-14859275 TTGAGTTCAGGCTGGTGTGCTGG - Intergenic
1201543191 Y:15131786-15131808 TCAACCTCAGACTGCTGTCCTGG - Intergenic
1201591229 Y:15617057-15617079 TGGACTTCAGACTGTTGTGCTGG - Intergenic
1201651613 Y:16294882-16294904 TTGACTTCAGACTGCTGTGCTGG - Intergenic
1201690004 Y:16752890-16752912 TTGATTTCAGACTGCTGTACTGG + Intergenic
1201692898 Y:16789104-16789126 TTGACTTCAGTCTGCTGTGCTGG - Intergenic
1201707137 Y:16949859-16949881 TTGAACTCAGACTGGTGTGCTGG - Intergenic
1201850931 Y:18478872-18478894 TTGGCTTCAGACTACTGTGCTGG + Intergenic
1201882388 Y:18841506-18841528 TTGGCTTCAGACTACTGTGCTGG - Intergenic
1201931990 Y:19360571-19360593 TCCACTTCAGACTGCTGTGCTGG - Intergenic
1201946377 Y:19515066-19515088 TAGACTTCAGACTGCTGCGCTGG - Intergenic
1201979354 Y:19890827-19890849 TCAATTTCAGACTGCTGTGCTGG + Intergenic
1202330618 Y:23748843-23748865 TTGACTTAAGACTACTGTGCTGG - Intergenic
1202347911 Y:23954550-23954572 TTAACTTCAGACTACTGCACTGG - Intergenic
1202522862 Y:25715554-25715576 TTAACTTCAGACTACTGCACTGG + Intergenic
1202540151 Y:25921218-25921240 TTGACTTAAGACTACTGTGCTGG + Intergenic