ID: 981296656

View in Genome Browser
Species Human (GRCh38)
Location 4:143140655-143140677
Sequence CCACAAAGCTCCAGTGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981296656_981296664 1 Left 981296656 4:143140655-143140677 CCTGGGACACTGGAGCTTTGTGG No data
Right 981296664 4:143140679-143140701 GGAGGGGCCCACCATTACAGAGG No data
981296656_981296667 11 Left 981296656 4:143140655-143140677 CCTGGGACACTGGAGCTTTGTGG No data
Right 981296667 4:143140689-143140711 ACCATTACAGAGGCTTGAATAGG No data
981296656_981296669 14 Left 981296656 4:143140655-143140677 CCTGGGACACTGGAGCTTTGTGG No data
Right 981296669 4:143140692-143140714 ATTACAGAGGCTTGAATAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981296656 Original CRISPR CCACAAAGCTCCAGTGTCCC AGG (reversed) Intergenic