ID: 981296664

View in Genome Browser
Species Human (GRCh38)
Location 4:143140679-143140701
Sequence GGAGGGGCCCACCATTACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981296652_981296664 24 Left 981296652 4:143140632-143140654 CCAGTACAGCAGTCTGAAGTCAA 0: 12
1: 225
2: 418
3: 604
4: 474
Right 981296664 4:143140679-143140701 GGAGGGGCCCACCATTACAGAGG No data
981296656_981296664 1 Left 981296656 4:143140655-143140677 CCTGGGACACTGGAGCTTTGTGG No data
Right 981296664 4:143140679-143140701 GGAGGGGCCCACCATTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981296664 Original CRISPR GGAGGGGCCCACCATTACAG AGG Intergenic
No off target data available for this crispr