ID: 981297387

View in Genome Browser
Species Human (GRCh38)
Location 4:143147419-143147441
Sequence ATATCCTGCTTCACAAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981297386_981297387 0 Left 981297386 4:143147396-143147418 CCACACACGAAGGGGTCAAGGAA No data
Right 981297387 4:143147419-143147441 ATATCCTGCTTCACAAATACAGG No data
981297385_981297387 1 Left 981297385 4:143147395-143147417 CCCACACACGAAGGGGTCAAGGA No data
Right 981297387 4:143147419-143147441 ATATCCTGCTTCACAAATACAGG No data
981297379_981297387 17 Left 981297379 4:143147379-143147401 CCCGCGCACTGCAGTTCCCACAC No data
Right 981297387 4:143147419-143147441 ATATCCTGCTTCACAAATACAGG No data
981297380_981297387 16 Left 981297380 4:143147380-143147402 CCGCGCACTGCAGTTCCCACACA No data
Right 981297387 4:143147419-143147441 ATATCCTGCTTCACAAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981297387 Original CRISPR ATATCCTGCTTCACAAATAC AGG Intergenic