ID: 981298971

View in Genome Browser
Species Human (GRCh38)
Location 4:143165777-143165799
Sequence GACTAGCCAGGGCAATAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981298971_981298976 19 Left 981298971 4:143165777-143165799 CCTCACTATTGCCCTGGCTAGTC No data
Right 981298976 4:143165819-143165841 CAATATTCCCGCCGCACTTAAGG No data
981298971_981298975 -10 Left 981298971 4:143165777-143165799 CCTCACTATTGCCCTGGCTAGTC No data
Right 981298975 4:143165790-143165812 CTGGCTAGTCTCAAACTGCTGGG 0: 2
1: 29
2: 1206
3: 13866
4: 24318
981298971_981298977 24 Left 981298971 4:143165777-143165799 CCTCACTATTGCCCTGGCTAGTC No data
Right 981298977 4:143165824-143165846 TTCCCGCCGCACTTAAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981298971 Original CRISPR GACTAGCCAGGGCAATAGTG AGG (reversed) Intergenic
No off target data available for this crispr