ID: 981300163

View in Genome Browser
Species Human (GRCh38)
Location 4:143178161-143178183
Sequence AGCTACAGATCTTCCTACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981300163_981300168 15 Left 981300163 4:143178161-143178183 CCATAGTAGGAAGATCTGTAGCT No data
Right 981300168 4:143178199-143178221 AGCCCATATAATAACTCATAGGG No data
981300163_981300169 16 Left 981300163 4:143178161-143178183 CCATAGTAGGAAGATCTGTAGCT No data
Right 981300169 4:143178200-143178222 GCCCATATAATAACTCATAGGGG No data
981300163_981300171 17 Left 981300163 4:143178161-143178183 CCATAGTAGGAAGATCTGTAGCT No data
Right 981300171 4:143178201-143178223 CCCATATAATAACTCATAGGGGG No data
981300163_981300164 -8 Left 981300163 4:143178161-143178183 CCATAGTAGGAAGATCTGTAGCT No data
Right 981300164 4:143178176-143178198 CTGTAGCTCTGCCCAAATACAGG No data
981300163_981300167 14 Left 981300163 4:143178161-143178183 CCATAGTAGGAAGATCTGTAGCT No data
Right 981300167 4:143178198-143178220 GAGCCCATATAATAACTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981300163 Original CRISPR AGCTACAGATCTTCCTACTA TGG (reversed) Intergenic
No off target data available for this crispr