ID: 981304175

View in Genome Browser
Species Human (GRCh38)
Location 4:143228773-143228795
Sequence CAAATGTTGTGACGTGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981304175_981304176 1 Left 981304175 4:143228773-143228795 CCAGATACACGTCACAACATTTG No data
Right 981304176 4:143228797-143228819 ATTCCACAACCATAATACTGAGG No data
981304175_981304180 29 Left 981304175 4:143228773-143228795 CCAGATACACGTCACAACATTTG No data
Right 981304180 4:143228825-143228847 ACAAAAGAATGCCCATCTTGTGG No data
981304175_981304177 2 Left 981304175 4:143228773-143228795 CCAGATACACGTCACAACATTTG No data
Right 981304177 4:143228798-143228820 TTCCACAACCATAATACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981304175 Original CRISPR CAAATGTTGTGACGTGTATC TGG (reversed) Intergenic
No off target data available for this crispr