ID: 981305376

View in Genome Browser
Species Human (GRCh38)
Location 4:143241524-143241546
Sequence CTGTATCCAGGGATAGAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981305370_981305376 -5 Left 981305370 4:143241506-143241528 CCTACAATGCACCAGTGACTGTA No data
Right 981305376 4:143241524-143241546 CTGTATCCAGGGATAGAATGGGG No data
981305368_981305376 21 Left 981305368 4:143241480-143241502 CCTTTCCTCTATGTAATTATTAA No data
Right 981305376 4:143241524-143241546 CTGTATCCAGGGATAGAATGGGG No data
981305369_981305376 16 Left 981305369 4:143241485-143241507 CCTCTATGTAATTATTAAATACC No data
Right 981305376 4:143241524-143241546 CTGTATCCAGGGATAGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981305376 Original CRISPR CTGTATCCAGGGATAGAATG GGG Intergenic
No off target data available for this crispr