ID: 981311159

View in Genome Browser
Species Human (GRCh38)
Location 4:143299278-143299300
Sequence TGGCAGAGCCAAGGTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981311159_981311169 23 Left 981311159 4:143299278-143299300 CCCTGCCCACCTTGGCTCTGCCA No data
Right 981311169 4:143299324-143299346 TTGTTAGATTGTAAATTCCAGGG No data
981311159_981311168 22 Left 981311159 4:143299278-143299300 CCCTGCCCACCTTGGCTCTGCCA No data
Right 981311168 4:143299323-143299345 TTTGTTAGATTGTAAATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981311159 Original CRISPR TGGCAGAGCCAAGGTGGGCA GGG (reversed) Intergenic
No off target data available for this crispr