ID: 981315523

View in Genome Browser
Species Human (GRCh38)
Location 4:143336655-143336677
Sequence ACCCACCCTCCCCCGAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981315519_981315523 6 Left 981315519 4:143336626-143336648 CCTCGGCGTTCACCGAGCGCCGC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 981315523 4:143336655-143336677 ACCCACCCTCCCCCGAGGAGAGG 0: 1
1: 0
2: 0
3: 16
4: 185
981315517_981315523 12 Left 981315517 4:143336620-143336642 CCCTTTCCTCGGCGTTCACCGAG 0: 1
1: 0
2: 1
3: 1
4: 44
Right 981315523 4:143336655-143336677 ACCCACCCTCCCCCGAGGAGAGG 0: 1
1: 0
2: 0
3: 16
4: 185
981315518_981315523 11 Left 981315518 4:143336621-143336643 CCTTTCCTCGGCGTTCACCGAGC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 981315523 4:143336655-143336677 ACCCACCCTCCCCCGAGGAGAGG 0: 1
1: 0
2: 0
3: 16
4: 185
981315516_981315523 13 Left 981315516 4:143336619-143336641 CCCCTTTCCTCGGCGTTCACCGA 0: 1
1: 0
2: 1
3: 1
4: 35
Right 981315523 4:143336655-143336677 ACCCACCCTCCCCCGAGGAGAGG 0: 1
1: 0
2: 0
3: 16
4: 185
981315520_981315523 -6 Left 981315520 4:143336638-143336660 CCGAGCGCCGCGAAGTGACCCAC 0: 1
1: 0
2: 0
3: 1
4: 30
Right 981315523 4:143336655-143336677 ACCCACCCTCCCCCGAGGAGAGG 0: 1
1: 0
2: 0
3: 16
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981315523 Original CRISPR ACCCACCCTCCCCCGAGGAG AGG Intergenic
900106600 1:984109-984131 AGCCACCCTCCCACCAGGAAGGG - Intergenic
901033424 1:6321915-6321937 ACCCACAATACCACGAGGAGTGG - Intronic
901261435 1:7874656-7874678 CCCCACCATCCCCCCAGCAGCGG + Intergenic
901655746 1:10768172-10768194 ACCCACCCTGCCCTGAGCAGAGG - Intronic
903027934 1:20442848-20442870 ACCCACCACCCTCCTAGGAGGGG + Intergenic
903069552 1:20720338-20720360 TCCAACCCTCCCGTGAGGAGAGG - Intronic
905110440 1:35590617-35590639 AGCTCCCCTCCCCCCAGGAGAGG + Exonic
905967633 1:42112758-42112780 TCCCACCCTCCCCTGAGCATGGG + Intergenic
909995109 1:82269501-82269523 TCCCACCCTCCCCCTACGAATGG - Intergenic
911348094 1:96721515-96721537 ACCCACGCCCCCACAAGGAGGGG + Intergenic
912529707 1:110311548-110311570 ACCCACCATCCCTCCTGGAGAGG + Intergenic
912549960 1:110479161-110479183 ACCCACCCTCCCCAGATGCCGGG - Intergenic
915868193 1:159528446-159528468 TCCCACCCTCCCTCTAGGAGGGG + Intergenic
916713901 1:167434466-167434488 ACCCTCCCTCCCCACAGGAGGGG + Intronic
920305826 1:205017537-205017559 ACCCACCCTGTCCAGAGTAGAGG + Exonic
922739964 1:228009180-228009202 AGCCAGCCTCCCCCAAGGGGAGG - Intronic
922822291 1:228492995-228493017 ACCCACCCTCCCCAGGGGAAGGG - Intronic
923056081 1:230426457-230426479 CCCCACCCTCCTCCGCGGGGCGG + Intergenic
923108106 1:230869207-230869229 ACCCACCTGGCCCCGAGGGGCGG - Intronic
923628539 1:235634093-235634115 CCTCACCCTCCCTGGAGGAGTGG - Intronic
1062946511 10:1465781-1465803 TCCCACCCCCGCCCGAAGAGTGG + Intronic
1067428601 10:46227513-46227535 GCTGCCCCTCCCCCGAGGAGGGG + Intergenic
1067830663 10:49609719-49609741 ACACACACTCCCGCCAGGAGGGG - Intronic
1069769362 10:70887931-70887953 CCCCACCCACCCCCGGGGCGGGG - Intronic
1070691920 10:78533354-78533376 ACCCTCCAGGCCCCGAGGAGAGG + Intergenic
1071510854 10:86261734-86261756 ACCCACTCTCACCTGAGCAGGGG + Intronic
1075591160 10:123692599-123692621 ACCCACCCTCTCCCCAGGTCCGG - Exonic
1075626020 10:123965094-123965116 ACCCACCAGCCCTGGAGGAGGGG + Intergenic
1076147126 10:128131683-128131705 ACCCACCAGCCCCTGAGGAAAGG - Intergenic
1077421555 11:2452500-2452522 CCCCACCCTGCCCCAAAGAGGGG + Intronic
1077685062 11:4283379-4283401 ACCCACCTCCCTCCCAGGAGGGG - Intergenic
1077690126 11:4334551-4334573 ACCCACCTCCCTCCCAGGAGGGG + Intergenic
1078100869 11:8329535-8329557 TCCAACCCTCCCCAGGGGAGAGG - Intergenic
1078268808 11:9775576-9775598 ACCCTCCCTCCCCCGAGGTTGGG - Intergenic
1078514365 11:12009399-12009421 GCCCACCCCGCCCCGCGGAGGGG + Intronic
1080819371 11:35790702-35790724 AGCAACCCTCCTCCCAGGAGGGG + Intronic
1081990081 11:47332968-47332990 TCCCTCCCTGCCCCCAGGAGTGG - Exonic
1082014144 11:47471762-47471784 ACCCACCCTCACACTAAGAGAGG + Intronic
1084757688 11:71250113-71250135 TCCCCCCCACCCCCGGGGAGGGG - Intronic
1084784861 11:71436336-71436358 ACCCACCTTCCCCAAAGAAGAGG + Intronic
1084907309 11:72358032-72358054 TCCCACACTCTCCCAAGGAGAGG + Intronic
1091556479 12:1577325-1577347 CACTGCCCTCCCCCGAGGAGGGG - Intronic
1091888163 12:4031651-4031673 ACCCCGTCTCCCCGGAGGAGAGG + Intergenic
1092124820 12:6067680-6067702 ACCCATCCTCCACCCAGGATGGG + Intronic
1093731177 12:22567691-22567713 GCACTCCCTCCCCTGAGGAGTGG - Intergenic
1095052729 12:37568608-37568630 ACCCTCCCACCCCTGGGGAGTGG + Intergenic
1096718142 12:53503186-53503208 ACCCACTCTGCCCCGAGGCCTGG + Intronic
1100315505 12:93441572-93441594 CCCCACCCTCCGCCGGGGCGTGG + Intronic
1100531895 12:95468783-95468805 ACACTCCCTCCCGTGAGGAGTGG - Intergenic
1104081988 12:125437131-125437153 ACCCACCATCCACTCAGGAGGGG + Intronic
1104764103 12:131315361-131315383 CCTCTCCCTCCCCCGAGCAGTGG - Intergenic
1106701714 13:32235794-32235816 GCCCACCCTCCCCTCAGCAGAGG + Intronic
1107655831 13:42591395-42591417 CCTCACCCTCCCCAGAGGAGAGG - Intronic
1108063585 13:46554751-46554773 ACAAACCCTCCCCCAGGGAGCGG - Intronic
1109630127 13:65034449-65034471 TCTCACCCTCCCCCGTGCAGCGG + Intergenic
1110924674 13:81136743-81136765 ACCCCTCATCCCCAGAGGAGGGG - Intergenic
1114269250 14:21091133-21091155 ACCCACTCTCCCCAGGCGAGCGG - Exonic
1117105785 14:52395781-52395803 ACCCACCTACCCCCAAGGATGGG + Intergenic
1117981970 14:61350618-61350640 ATCCCCCCTCCCCCATGGAGGGG + Intronic
1122909888 14:104822401-104822423 ACCCACGTTCCCCAGAGGACCGG + Intergenic
1122940279 14:104978137-104978159 GCCCACCCGCCCCAGGGGAGCGG + Intronic
1125594975 15:40879054-40879076 ACCCAGCCTACCCTTAGGAGGGG - Intergenic
1125972041 15:43919716-43919738 TCCCACCCTCCCCAGGGGTGTGG + Intronic
1127884622 15:63188875-63188897 ATCCATCCTCCTGCGAGGAGAGG + Intergenic
1128108223 15:65059646-65059668 ACAGACCCACCCCCGAGGTGTGG - Intronic
1128259766 15:66224974-66224996 ACCCTTCCTCCCAGGAGGAGAGG - Intronic
1129868419 15:78925894-78925916 ACCTACCTTCCCCCTTGGAGGGG - Intronic
1130561567 15:84963318-84963340 ATACACCCTCTCCCCAGGAGTGG + Intergenic
1131529634 15:93180440-93180462 ACCCACCGTCCCCCAGGCAGGGG + Intergenic
1132282342 15:100631012-100631034 ACCCACTCTACCCCTTGGAGCGG + Intronic
1132450618 15:101966236-101966258 ACCCACCCCCACCTGATGAGAGG + Intergenic
1132698559 16:1212571-1212593 GCCCGCCCTTCCCCGAGCAGCGG - Intronic
1132856463 16:2047310-2047332 AGGCACCCTCCCCCGAGCTGGGG + Intronic
1132881390 16:2163153-2163175 AATCACCCTCCCCAGAAGAGAGG - Intronic
1133090274 16:3398760-3398782 ACCAGTTCTCCCCCGAGGAGAGG - Intronic
1136135647 16:28255446-28255468 AACCACCATCCCTCTAGGAGGGG + Intergenic
1137729722 16:50680667-50680689 ACCCACCCTTTCCCCAAGAGAGG - Intronic
1137830045 16:51535847-51535869 ACCAAGCATGCCCCGAGGAGGGG - Intergenic
1137954931 16:52819679-52819701 TCCCACCTTCCCTCCAGGAGAGG - Intergenic
1142104809 16:88296844-88296866 ACCCACACCCCACCGAGGGGAGG + Intergenic
1142671726 17:1490823-1490845 CCCACCCCTCCCCCCAGGAGGGG + Intronic
1143147416 17:4785766-4785788 CCCCGACCTCCGCCGAGGAGCGG + Intronic
1144727449 17:17508906-17508928 ACCCATCTTCCCCGCAGGAGGGG - Intronic
1145373248 17:22324547-22324569 ACCCTCCCACCCCTGGGGAGTGG + Intergenic
1146063186 17:29617614-29617636 TCTCCCCCTCCCCCCAGGAGAGG - Exonic
1147387513 17:40090955-40090977 TCCCTCTCTCCCCTGAGGAGTGG - Intronic
1148957635 17:51366674-51366696 ACTCTCCCTCCTGCGAGGAGTGG + Intergenic
1149577795 17:57726529-57726551 ACCCTCCCTCCCATGAGGGGAGG - Intergenic
1150581399 17:66477077-66477099 ACCCACCCTACCAGGACGAGGGG + Intronic
1151226591 17:72652539-72652561 ACTCACCCTCACCCCAGGACAGG - Intronic
1151662212 17:75525187-75525209 CCGCACCCCCCCCCGAGGAAAGG + Intronic
1152350691 17:79782428-79782450 CCCCTCCCTCCCCTGAGGACAGG + Intronic
1152435002 17:80271090-80271112 ACCTACCCTCCCACCAGGGGCGG - Intronic
1154035493 18:10797826-10797848 TCCCACCCACACTCGAGGAGAGG - Intronic
1156495029 18:37520022-37520044 CCCCAGTCTCCCCCAAGGAGAGG - Intronic
1156608520 18:38698121-38698143 ACCTCCCCTCCCCCGATGGGGGG - Intergenic
1157225472 18:45859318-45859340 ACCCTCGCTCCCCCAAAGAGTGG - Intronic
1161041122 19:2111251-2111273 GCCCACCCTGCCCCTGGGAGCGG + Intronic
1161123019 19:2540528-2540550 GCCCACCCACCCCCGAGCAGGGG - Intronic
1161438297 19:4277153-4277175 CCCGACCCTACCCCAAGGAGGGG - Intergenic
1162781949 19:13011186-13011208 ACCCCCCCTCCCCCAAGGGCCGG + Intronic
1163182900 19:15616667-15616689 CTCCACCCTCCCCCGTGCAGGGG + Intronic
1165570320 19:36770293-36770315 ACCCTCCCACCCCTGGGGAGTGG - Intronic
925290948 2:2748421-2748443 ACCCACCCACCCACCGGGAGAGG - Intergenic
926382134 2:12301450-12301472 TCCCAGCCTCCCACGGGGAGTGG + Intergenic
926681658 2:15668702-15668724 AGACAGCCTCCCCAGAGGAGGGG - Intergenic
926990702 2:18676860-18676882 CCTCACCCTCCCCCAATGAGAGG - Intergenic
929953145 2:46432450-46432472 ACTCACCCTCCCCCCAGGTTGGG - Intronic
931195986 2:60052679-60052701 ATCCACCCTCACCCCATGAGTGG - Intergenic
931517132 2:63056505-63056527 ACCCACCCTGCCCCTTGGATGGG + Exonic
938757212 2:134391855-134391877 AACCACCCTCCCTCCTGGAGAGG - Intronic
941653748 2:168121422-168121444 ACCCTCCCTGCCCTGAGAAGGGG - Intronic
946230341 2:218287341-218287363 ACACACCCTCTCCCAAGGAGGGG + Intronic
947114501 2:226754269-226754291 ACCCACCCTCACTCCAGGAATGG - Intronic
948760181 2:240185422-240185444 ACCCACCCTTCACCTAGGAGTGG - Intergenic
948760243 2:240185778-240185800 ACCCACCCTTCACCTAGGAGTGG - Intergenic
1168982814 20:2022290-2022312 GCCCACCTTCTCCCCAGGAGAGG - Intergenic
1171529545 20:25843780-25843802 ACCCTCCCACCCCTGGGGAGTGG - Intronic
1171547281 20:26012100-26012122 ACCCTCCCACCCCTGGGGAGTGG + Intergenic
1175962183 20:62642709-62642731 TCCTGCCCTCCCCCGCGGAGAGG - Intronic
1175987525 20:62771351-62771373 GCCCTCCCTCCCCCGCCGAGTGG - Intergenic
1176297639 21:5082771-5082793 GCCCACCCTCCCCTGAGTGGAGG - Intergenic
1178041152 21:28642347-28642369 ACGCTCCCTCCCATGAGGAGTGG - Intergenic
1179859390 21:44179178-44179200 GCCCACCCTCCCCTGAGTGGAGG + Intergenic
1180048991 21:45322866-45322888 ACCCACCCTCCCCTCAGGCAGGG + Intergenic
1181031229 22:20149635-20149657 ACCCCACCTCCCCCTAGGTGTGG - Exonic
1181322950 22:22022718-22022740 CCCCACCCTCTGCAGAGGAGGGG - Intergenic
1181490591 22:23258659-23258681 ACACCCTCTCCCCCGAGGTGTGG - Intronic
1181538858 22:23562409-23562431 ACCCCCCTTCCTCCGAGAAGTGG + Intergenic
1181759907 22:25051123-25051145 ACCCACCTACCTCTGAGGAGAGG - Intronic
1184472609 22:44704295-44704317 TCCCTCCCACCCCCGAGGTGGGG + Intronic
1184919721 22:47597251-47597273 ACCCTGCCTGCCCCGTGGAGAGG + Intergenic
1185221678 22:49632210-49632232 ACCCTGCCTGGCCCGAGGAGGGG - Intronic
1185376993 22:50487269-50487291 ACCCACCAGCCCTCGAGCAGAGG + Intronic
950098396 3:10343261-10343283 CCCCTCCAGCCCCCGAGGAGGGG + Intronic
953016316 3:39080199-39080221 CCCCTCCCTCCCCCTAGGTGTGG + Intronic
954364807 3:50140081-50140103 ACCCATCCTTCCCCGAGGGATGG - Intergenic
954419693 3:50412248-50412270 ACCCACCCTGCCCAGATGTGGGG - Intronic
954460813 3:50625904-50625926 CCCCACCCTCCCCTGGGGTGGGG - Intronic
954764000 3:52897664-52897686 CCCCACCCGCCCCCGAGGGGCGG + Intergenic
963066589 3:141269157-141269179 ACCCACCCACCCTCAAGGACAGG + Intronic
963215717 3:142745269-142745291 CCCCACCCTTCCCCCAGGAAAGG - Intronic
966992067 3:185242851-185242873 TCCCACCCTCCCCCGAGTTCTGG + Intronic
967649978 3:191973932-191973954 CCCCACCCTCCTGCGTGGAGTGG - Intergenic
967946143 3:194805739-194805761 ACCCACCATGCCCCGTGGACTGG + Intergenic
968453689 4:686848-686870 ACCCTGCCTCCCCCGAGGGCGGG + Intronic
968589343 4:1449834-1449856 ACCCAGCTTCCCACGGGGAGTGG - Intergenic
968602529 4:1517082-1517104 TGCCTCCCTCCCCTGAGGAGGGG - Intergenic
968808306 4:2788805-2788827 ACACAGCCTCCCCCAGGGAGTGG + Intergenic
975401568 4:73944532-73944554 ACCCACCCACCCCGGGGGTGGGG - Intergenic
979195500 4:117916133-117916155 ACTCCCCCTTCCCCTAGGAGTGG + Intergenic
979656832 4:123204966-123204988 ACCCACTCTCCAGTGAGGAGGGG - Intronic
981315523 4:143336655-143336677 ACCCACCCTCCCCCGAGGAGAGG + Intergenic
982259988 4:153486770-153486792 ACCCACCCACGCCTGTGGAGTGG + Intronic
986306554 5:6520842-6520864 ACACTCACACCCCCGAGGAGAGG - Intergenic
988264795 5:28934190-28934212 GCCCCCCCGCCCCGGAGGAGAGG + Intergenic
988505459 5:31818425-31818447 ACCCATCCTCCCCAGAGAACTGG + Intronic
991708721 5:69385382-69385404 CCTCAGCCTCCCCCGAGTAGTGG + Intronic
995274430 5:110262129-110262151 TCCCACTCTCCCACAAGGAGAGG - Intergenic
997518384 5:134506534-134506556 CCCCACCCTGCCCAGGGGAGAGG - Intergenic
999954027 5:156680920-156680942 ACACTCCCTCCCATGAGGAGTGG - Intronic
1002281107 5:178130718-178130740 ACCCGCCCGCCGGCGAGGAGCGG + Intergenic
1002643339 5:180640874-180640896 ACCCACACTGCCCCGTAGAGAGG - Intronic
1003193974 6:3898761-3898783 ACGCTCCCTCTCGCGAGGAGTGG - Intergenic
1007473592 6:42105532-42105554 GCCCACCCTGGCCAGAGGAGGGG - Exonic
1007849749 6:44791788-44791810 TCCCCCGCTCCCCCAAGGAGGGG + Intergenic
1010637804 6:78282647-78282669 ACTCTCCCTTCCCCTAGGAGTGG + Intergenic
1017782403 6:157726043-157726065 ACACTCCCTCTCACGAGGAGTGG + Intronic
1019335322 7:480069-480091 ATCCACCCTCCCCCGGCCAGCGG + Intergenic
1019490531 7:1311191-1311213 ACTCACAGTTCCCCGAGGAGGGG - Intergenic
1019595667 7:1857248-1857270 ACCCACCCTCGCCCGAGACGTGG - Intronic
1021420406 7:20440185-20440207 ACACTCCCTCCCGCAAGGAGTGG + Intergenic
1021420843 7:20443254-20443276 ACACTCCCTCCCACGAGGAGTGG + Intergenic
1022514250 7:30965386-30965408 CCCCACCCACCCCTGAGGGGAGG - Intronic
1024232398 7:47372540-47372562 TCATACCCTCCCCCCAGGAGAGG - Intronic
1025610261 7:63071486-63071508 CCCCACCCTCCCCCAAAGTGAGG + Intergenic
1026858072 7:73768107-73768129 ACACACACACCCCAGAGGAGTGG - Intergenic
1026977658 7:74508212-74508234 CCCCACCCACCCAAGAGGAGGGG + Intronic
1030084411 7:105804377-105804399 ACCCACCCTGCCCCAAGGTAAGG + Intronic
1033601492 7:142892114-142892136 ACCCACCTTCCACTGAGGAGGGG - Intergenic
1034197848 7:149262007-149262029 ACCCACCCTCACCCGGGGCGCGG - Intergenic
1034549817 7:151813364-151813386 ATCAAGCCTCCCCCCAGGAGGGG + Intronic
1035005325 7:155653564-155653586 CCCCAGCCTCCCTCGAGGGGAGG + Intronic
1035023930 7:155814562-155814584 ACCCACCCTGCCCCTTGCAGAGG - Intergenic
1035154292 7:156899564-156899586 ACTGACCCTCCCCTGAGTAGGGG - Intergenic
1035953870 8:4054308-4054330 ACCCCAGCTCCCCAGAGGAGAGG - Intronic
1037960371 8:23093023-23093045 GTCCACCTTCCCCAGAGGAGAGG + Intronic
1040481461 8:47831448-47831470 ACCCACGGTGCCCCGAGGACAGG - Intronic
1048986520 8:139737850-139737872 TCCCAACCTTCCCTGAGGAGGGG + Intronic
1049655106 8:143793805-143793827 ACCCCCCATCCCTGGAGGAGGGG + Intronic
1053797521 9:41740078-41740100 ACCCTCCCACCCCTGGGGAGTGG - Intergenic
1054185933 9:61952130-61952152 ACCCTCCCACCCCTGGGGAGTGG - Intergenic
1056832984 9:89931537-89931559 CACGACCCTCCTCCGAGGAGAGG + Intergenic
1057827289 9:98380802-98380824 ACCCACCCTCGTCCGAGCAGAGG + Intronic
1059501306 9:114756515-114756537 AAACACCCTCCTCAGAGGAGAGG - Intergenic
1060182741 9:121545611-121545633 CCCCAACCACCGCCGAGGAGTGG + Intergenic
1062170943 9:135134306-135134328 CCACCCCCTCCCCCGGGGAGTGG + Intergenic
1186219684 X:7336244-7336266 CCCCACCCGCCCCAAAGGAGGGG + Intronic
1188182471 X:27072945-27072967 GCTCACCCTCCCACGAGGGGTGG + Intergenic
1192589592 X:72348929-72348951 AATCACCCTCCCCCAAGGAAGGG + Intronic
1195660432 X:107372564-107372586 ACCCATCATTCCCAGAGGAGAGG - Intergenic
1197075582 X:122349542-122349564 CCTCACCCACCCCCGAGCAGTGG + Intergenic