ID: 981316758

View in Genome Browser
Species Human (GRCh38)
Location 4:143348232-143348254
Sequence AATTATCAACATATAATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 442}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981316758_981316762 19 Left 981316758 4:143348232-143348254 CCCTGAATTATATGTTGATAATT 0: 1
1: 0
2: 3
3: 46
4: 442
Right 981316762 4:143348274-143348296 CATTTCTCATTCCAGATCTATGG No data
981316758_981316763 28 Left 981316758 4:143348232-143348254 CCCTGAATTATATGTTGATAATT 0: 1
1: 0
2: 3
3: 46
4: 442
Right 981316763 4:143348283-143348305 TTCCAGATCTATGGCTCTAATGG 0: 1
1: 0
2: 1
3: 11
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981316758 Original CRISPR AATTATCAACATATAATTCA GGG (reversed) Intronic
903937070 1:26903308-26903330 AATGATTAACATAAAATCCAGGG + Intronic
904262046 1:29293427-29293449 AATTATAAACACAAATTTCAAGG - Intronic
906576911 1:46899362-46899384 GATTATAAACATAAAATTCCTGG + Intergenic
906595007 1:47068227-47068249 AATTATAAACATAAAATTCCTGG - Intronic
906832212 1:49044929-49044951 AATTATTATCTTATAATTCCAGG - Intronic
908108339 1:60869480-60869502 AATTAAGAACACATATTTCACGG + Intronic
908121565 1:60990907-60990929 AATTATCAACTCATAAATCTTGG + Intronic
909043079 1:70676803-70676825 AATTATAAACTTATACTTTAGGG - Intergenic
909195802 1:72621521-72621543 AAAAATCAACAAATAAATCAAGG - Intergenic
909574944 1:77163877-77163899 AATTACCAACATAGAACTCGCGG - Exonic
910769310 1:90815017-90815039 TATGATCAACATCTGATTCAGGG + Intergenic
911027905 1:93454556-93454578 AATTAGTAACATATTATTAAAGG - Intronic
911740846 1:101385352-101385374 TATCATCAACATAGAAATCATGG - Intergenic
911748989 1:101474147-101474169 AACTATCAACATAGAACTGAAGG + Intergenic
911880405 1:103231305-103231327 AATTACGAACATATAATTTATGG - Intergenic
912150978 1:106858297-106858319 AATTATGGACAAAGAATTCATGG + Intergenic
913285906 1:117226369-117226391 GATTATGAACATACAGTTCACGG + Intergenic
913427389 1:118749106-118749128 AATTACCACCATGTAATTCATGG + Intergenic
916154057 1:161826859-161826881 AATTCCCAACATTTGATTCAGGG - Intronic
917000346 1:170351108-170351130 ATTTATTAACAAATATTTCAGGG - Intergenic
917596174 1:176531430-176531452 AATTCTCAGAATATAATTCCAGG - Intronic
917666804 1:177232949-177232971 AATAATAAACCTATGATTCAAGG + Intronic
918607109 1:186441239-186441261 AATTATAAATATATTATGCAAGG + Intergenic
918656234 1:187029074-187029096 AAATATTAATAGATAATTCATGG + Intergenic
918754092 1:188314150-188314172 ATTGATAAATATATAATTCAAGG + Intergenic
921849673 1:219921587-219921609 AAATTGCAACAAATAATTCATGG + Intronic
921890122 1:220345276-220345298 AATTATCAAGCTATCATTTAAGG - Intergenic
922650391 1:227333069-227333091 AAGTATCAACTTCTAAGTCATGG - Intergenic
1063086011 10:2818269-2818291 ATTTATCATTATTTAATTCAAGG + Intergenic
1064542998 10:16424140-16424162 AATAATTAACATAAAATTCAGGG + Intergenic
1064618389 10:17188249-17188271 ATTTATAAAGATATAATTCCAGG + Intronic
1065387913 10:25151753-25151775 AATTATAAACACAGGATTCAGGG - Intergenic
1067351208 10:45477007-45477029 AGATATCCAAATATAATTCAAGG + Intronic
1067395495 10:45913170-45913192 ATTTATCAAAATAAAATTAAAGG - Intergenic
1067863816 10:49882293-49882315 ATTTATCAAAATAAAATTAAAGG - Intronic
1068160047 10:53252094-53252116 AAGTTTCAACATATAATTTTAGG - Intergenic
1068160900 10:53262886-53262908 AATTATTACTATATAATTCATGG + Intergenic
1068193109 10:53679823-53679845 AAATATCAACATTTATTTCTAGG + Intergenic
1068196062 10:53718173-53718195 GACTATCAACATATAATTAATGG - Intergenic
1069181780 10:65370038-65370060 AATTATAAACAAATATGTCACGG + Intergenic
1069356240 10:67588721-67588743 AATTATCCACTTATAAGTTAAGG + Intronic
1071221511 10:83471831-83471853 AATTATAAACATAAAATTTTAGG + Intergenic
1071888284 10:89974396-89974418 ACTTATAAAAATATAATTCCAGG - Intergenic
1071969344 10:90887335-90887357 ATATATCATCATATATTTCAAGG + Intronic
1071997048 10:91159763-91159785 ACTTACCCACAGATAATTCAAGG + Intergenic
1072485555 10:95851297-95851319 AATTAAAAAAATAAAATTCATGG - Intronic
1073638613 10:105225537-105225559 AATAGTCAACATAAAATTGAAGG - Intronic
1073642398 10:105266172-105266194 AATTATCAACAAATGATTTCTGG - Intergenic
1073998519 10:109343243-109343265 AAATATAAAGATATAACTCATGG + Intergenic
1076329030 10:129651601-129651623 AATTATCATCATGTAACTCTTGG - Intronic
1077666081 11:4110853-4110875 AATGAGCAACATATACATCAGGG - Intronic
1077729550 11:4715152-4715174 ACTTCTCAAAATATATTTCAAGG + Intronic
1077947319 11:6914724-6914746 ATTTCTCAAAATATGATTCATGG + Intergenic
1079594620 11:22227016-22227038 ATTTTTAAACATATATTTCATGG - Intronic
1079717440 11:23765968-23765990 AATTATTAACATATAAATATGGG + Intergenic
1079764634 11:24376253-24376275 AATTATCCACATAGACTACATGG + Intergenic
1079876551 11:25864984-25865006 AATTATAAAAATATATTTCTTGG - Intergenic
1080186881 11:29500097-29500119 AGATATTAACATATAATACAAGG + Intergenic
1081157515 11:39713620-39713642 AGCTATCAAGATATAATTTATGG - Intergenic
1081425861 11:42925959-42925981 AATTACCAAGACAAAATTCATGG - Intergenic
1081476361 11:43436279-43436301 AATTCTCAACAGAGAATACAGGG - Intronic
1085248854 11:75128082-75128104 AATAAACTACATATAATTCTCGG - Intronic
1086109569 11:83184731-83184753 AATGTTCAACATAATATTCAAGG - Exonic
1086588053 11:88478905-88478927 ATTTATCCTCATATAATACAAGG - Intergenic
1087382886 11:97430036-97430058 AATTATAAATATATAATTTGAGG + Intergenic
1087444364 11:98229217-98229239 AGTTTTCAACATATAATTTTGGG + Intergenic
1087709733 11:101534546-101534568 CATTATCAACACATAATTCTAGG - Intronic
1087730522 11:101773334-101773356 AATAATCATCATCTAACTCATGG + Intronic
1088128298 11:106456104-106456126 AATATTCAACAAATAATTGAAGG + Intergenic
1088171011 11:106996763-106996785 AATCATCAACATACTACTCAGGG + Intronic
1088313109 11:108480951-108480973 AATTCTCAAAATATAGTACAAGG - Intronic
1088531575 11:110816429-110816451 AATTATGAGAATATAATTCAAGG - Intergenic
1088565889 11:111172606-111172628 ATTCATCAACATTGAATTCATGG + Intergenic
1088965149 11:114712791-114712813 AATTATTTCCAAATAATTCAAGG + Intergenic
1089656821 11:119953865-119953887 AATGTTCAACATATATCTCATGG + Intergenic
1091260371 11:134229323-134229345 AGTCATCAGAATATAATTCATGG - Intronic
1092281235 12:7099273-7099295 AATTATTGAGATAAAATTCATGG - Intronic
1092310746 12:7349217-7349239 AAAAATCAATATATAATTAAGGG - Intronic
1092537215 12:9401650-9401672 AAATAACAAAATATAAATCATGG - Intergenic
1092557462 12:9571648-9571670 AAATAACAAAATATAAATCATGG + Intergenic
1093602620 12:21047519-21047541 CATTATAAACCTATAATTCATGG + Intronic
1093663720 12:21787455-21787477 GAGTAACAAAATATAATTCAGGG - Intergenic
1094380988 12:29842454-29842476 AATTAGCAAGATAAATTTCAGGG - Intergenic
1094513818 12:31116260-31116282 AAATAACAAAATATAAATCATGG - Intergenic
1094810090 12:34128080-34128102 AATTACCAACAAAAAATCCAAGG + Intergenic
1095129382 12:38520848-38520870 AATGATTAAAATATATTTCAAGG - Intergenic
1095142608 12:38684786-38684808 AATTATCTCAAAATAATTCAGGG + Intronic
1095335638 12:41022094-41022116 AATCGTCAATATATAATTCTTGG - Intronic
1095723584 12:45427567-45427589 AATTAAAAACAAATTATTCATGG - Intronic
1095732203 12:45518532-45518554 AATTACCACACTATAATTCAGGG + Intergenic
1095763835 12:45871697-45871719 AATTCACAACAAATAATTAAAGG - Intronic
1096725756 12:53560769-53560791 AACTATCAAGAAATAATACAAGG + Intronic
1097597896 12:61656940-61656962 ATTTATACAAATATAATTCAAGG + Intergenic
1097618949 12:61916894-61916916 AATTATGTACAGATACTTCATGG + Intronic
1098016786 12:66113647-66113669 AATTATTCACAGACAATTCATGG + Intergenic
1098107465 12:67084563-67084585 AACTATTAACAGTTAATTCATGG - Intergenic
1098129881 12:67339148-67339170 AATTTTAAAAATACAATTCAGGG - Intergenic
1098802636 12:74981410-74981432 AATATTAAACATATAATTTAGGG + Intergenic
1099514056 12:83574163-83574185 ACTTATCAATATACAATTTAAGG - Intergenic
1099977636 12:89562808-89562830 AATTCTCAACATATCCTACAAGG + Intergenic
1100235568 12:92657542-92657564 AAATATCAGCATATTATTTAGGG - Intergenic
1101357490 12:103994256-103994278 AATTTTCCACACATAGTTCAAGG - Intronic
1102599262 12:114016742-114016764 CATTTTCAACATAGAATTCATGG + Intergenic
1102723882 12:115041531-115041553 AATTATCAAGAAACATTTCAGGG - Intergenic
1103049822 12:117769320-117769342 CATTACCAGCATGTAATTCAGGG - Intronic
1103430689 12:120882947-120882969 TTTTATCAACATATAGTTCTGGG + Intronic
1104570647 12:129922324-129922346 AATTATCAACATATTCTGCTGGG - Intergenic
1105614435 13:21999511-21999533 TATTTTCAACAGAAAATTCAAGG - Intergenic
1106153376 13:27128041-27128063 AAGTTTCACCACATAATTCATGG + Intronic
1107066859 13:36223170-36223192 TATAATCAACATATATTTTATGG + Intronic
1108647038 13:52440714-52440736 ACTTATCAACATATGGTTTAAGG + Intronic
1108823888 13:54388346-54388368 AATCATCAAGATATAATATAAGG - Intergenic
1109127462 13:58534995-58535017 AGTTATGAATATATTATTCAAGG - Intergenic
1109154740 13:58893072-58893094 AATTATTTAAAAATAATTCAAGG - Intergenic
1109706671 13:66102234-66102256 CATTATCAAAATGTATTTCATGG + Intergenic
1109774684 13:67025053-67025075 AAATAATAACATATACTTCATGG - Intronic
1109928352 13:69178515-69178537 AATTATAAACCTATTATTTAGGG + Intergenic
1109966320 13:69701933-69701955 AATTTTCAATATACAAATCATGG - Intronic
1110063894 13:71076912-71076934 AGTGATCCACAGATAATTCAAGG - Intergenic
1110329416 13:74254060-74254082 AATAATTAAAAGATAATTCAAGG - Intergenic
1111198313 13:84901766-84901788 AGTTCTAAACATATACTTCAAGG - Intergenic
1111228620 13:85310544-85310566 AATAAACAACATATTATTTATGG - Intergenic
1111286352 13:86098096-86098118 AATTATGAAGATGCAATTCAGGG + Intergenic
1111299913 13:86335273-86335295 AATTATCTTCATATAATTAGTGG - Intergenic
1111482496 13:88849304-88849326 AATTATCACCAATTAATTTAAGG - Intergenic
1111980696 13:95012436-95012458 AATTTTAAACATGTAAGTCATGG + Intergenic
1112657184 13:101463470-101463492 AATTATGATCATATAAATCAGGG - Intronic
1112663955 13:101546210-101546232 AATCATAAACATAAAATTCAGGG + Intronic
1113020044 13:105874952-105874974 TATTTTCAAGATTTAATTCAAGG + Intergenic
1114778469 14:25513296-25513318 AATTGTTAGCATATAATTCAAGG + Intergenic
1115055379 14:29120074-29120096 AATTATGAATATCAAATTCATGG - Intergenic
1115788972 14:36857570-36857592 AATGGTCATCATTTAATTCAAGG + Intronic
1116615944 14:47139025-47139047 AGTTATTAACATATAATGAATGG + Intronic
1116663206 14:47738766-47738788 TATAATTAATATATAATTCAAGG - Intergenic
1117245594 14:53882095-53882117 AATTATAAACATATAAGTAATGG - Intergenic
1117568406 14:57020302-57020324 AATGAAGAACATATAATTAAGGG + Intergenic
1118156223 14:63244817-63244839 AATTTTCAACAAATAAATAAAGG + Intronic
1119160727 14:72450495-72450517 ATTTATCAATATATATTCCAGGG - Intronic
1120259015 14:82159112-82159134 AATTATGAATGGATAATTCATGG + Intergenic
1120287681 14:82525012-82525034 AATTAAAAAAAAATAATTCAAGG + Intergenic
1120298577 14:82676888-82676910 ACTTACCAACAAATACTTCATGG - Intergenic
1120717116 14:87851934-87851956 AAATATCAACATGCAAGTCATGG + Intronic
1123823496 15:24056699-24056721 AATTATCTACATATAATCATAGG - Intergenic
1125122563 15:36179639-36179661 GATTATCAACTAAGAATTCAGGG + Intergenic
1126220279 15:46205437-46205459 TATTATAAACATATATTTCCAGG + Intergenic
1127543797 15:59970075-59970097 AAATAACAATATATAATTAACGG + Intergenic
1128354736 15:66917751-66917773 AAACATCAACACATAAGTCAGGG + Intergenic
1128859754 15:71057924-71057946 ATTTATCAACATCAAACTCATGG - Intergenic
1129623232 15:77168928-77168950 AATTAGCAGCATGAAATTCAGGG + Intronic
1130216494 15:81975436-81975458 AATTATCAAAATAGAAATAAAGG + Intergenic
1131346445 15:91653698-91653720 AATTCTCAAGATAAAATTCTGGG + Intergenic
1134481196 16:14620692-14620714 AATCATTTACTTATAATTCAAGG + Intronic
1135941899 16:26829121-26829143 AAATAACAACACATAATTAAAGG + Intergenic
1137891624 16:52169096-52169118 AATTATCAACATAGAGATCTTGG + Intergenic
1138828028 16:60344541-60344563 ATTTATCAAAATAAACTTCATGG - Intergenic
1139500556 16:67360964-67360986 ATTTATTAACGTATAATTCTGGG - Intronic
1139615751 16:68089085-68089107 AATTACCAAGATCTAATTTATGG - Intronic
1143358487 17:6348632-6348654 AATTAACAACATAAATTTAATGG - Intergenic
1146135425 17:30316444-30316466 ATTAATTAACATATACTTCAAGG + Exonic
1147021190 17:37534646-37534668 AATTATCTACATACAATTTTAGG + Intronic
1147517633 17:41136219-41136241 AATTATATATATATAATTTAAGG + Intergenic
1149975742 17:61264142-61264164 AATTATATAGATATAATTCTTGG + Intronic
1150280386 17:63926757-63926779 AATTATCACAATAAAATTGAGGG - Intergenic
1150608818 17:66716640-66716662 AATTATCAACAGACAAATCTGGG + Intronic
1150766782 17:68008649-68008671 AATTATCGACTTAGACTTCATGG - Intergenic
1152287058 17:79418966-79418988 AATTATCCACATTTAACTGAGGG - Intronic
1153447739 18:5193396-5193418 CATGATTAATATATAATTCAGGG - Intronic
1154029616 18:10741682-10741704 TATAATCAATATATATTTCATGG + Intronic
1154133198 18:11753263-11753285 AACTGTCAACATATTATCCATGG + Intronic
1154944278 18:21146412-21146434 AATTATTCACATCTAATTTATGG + Intergenic
1155128930 18:22910556-22910578 ATTTATCATCTTATAATTCCAGG - Intronic
1156046593 18:32884521-32884543 AATTATCAATAAATATTTGATGG - Intergenic
1156796994 18:41058075-41058097 AAGTATGAAGTTATAATTCAGGG - Intergenic
1157189890 18:45572220-45572242 AATTCCCAAAATAGAATTCAAGG + Intronic
1158794987 18:60834809-60834831 AATAAGCCACATATAATTTAAGG + Intergenic
1159186367 18:64980426-64980448 AATTATGAACATATAAGCTAGGG + Intergenic
1159229083 18:65582144-65582166 ATTTAGCAACAAATAATTTAAGG - Intergenic
1159229223 18:65584160-65584182 ATTTAGCAACAAATAATTTAAGG + Intergenic
1159583251 18:70257455-70257477 AATTATGAAAATATAATAAATGG + Intergenic
1159792117 18:72794777-72794799 AAGTATCAATAGGTAATTCAAGG + Intronic
1160181084 18:76637038-76637060 ATTTAGCAACATATACTTTAAGG - Intergenic
1162782318 19:13012691-13012713 AATCATCAACATCGCATTCACGG - Intronic
1166424110 19:42661039-42661061 AATTTTCACCAAATATTTCATGG - Intronic
1167196035 19:48029328-48029350 CATTTTAAACATCTAATTCATGG + Intergenic
925744799 2:7034674-7034696 AATTATCAAGAAATAATTCTTGG - Intronic
926407305 2:12569013-12569035 TATCACCAACATATAATTGACGG + Intergenic
926872659 2:17440464-17440486 CATTATCAAAACATCATTCAAGG + Intergenic
930459727 2:51657413-51657435 AATTACCAAAATATGATTGATGG + Intergenic
931513584 2:63026749-63026771 ATATACCAACCTATAATTCAAGG + Intronic
934070130 2:88376317-88376339 ACTTATCAGCATAAAACTCAGGG + Intergenic
936118259 2:109719704-109719726 CTTTATTAAGATATAATTCATGG - Intergenic
936499762 2:113057068-113057090 GATTATCAAAAGATAATTCAGGG + Intergenic
936559152 2:113521384-113521406 CATTATAAACACATAATACATGG + Intergenic
936793206 2:116175589-116175611 AATTATATACCTATAATTTAAGG - Intergenic
936806661 2:116341172-116341194 AATAAACAACATATCAGTCATGG + Intergenic
938044092 2:128100739-128100761 AAGTAACAAAATGTAATTCAGGG - Intronic
938507363 2:131900416-131900438 AAGTATCACCATATTTTTCAGGG - Intergenic
938636317 2:133230615-133230637 ATTTATTTACATATAATTCAGGG + Intronic
939660172 2:144879412-144879434 AAATATTAACATTTTATTCATGG - Intergenic
939684877 2:145186703-145186725 AGATATCAACAGATAATTAAAGG + Intergenic
941636606 2:167941664-167941686 AATTTTAAATATAGAATTCAGGG + Intergenic
941650960 2:168092363-168092385 AATTAACAAGATAGAATTTATGG - Intronic
941652642 2:168109233-168109255 AATGATAAACACAAAATTCATGG - Intronic
941673248 2:168317743-168317765 AAATTCCAACATAAAATTCAAGG + Intergenic
941678188 2:168366641-168366663 GATTATCAAAATAAAATTCAGGG + Intergenic
941949430 2:171138244-171138266 ACTTATTAACATAAAATTTAAGG + Intronic
942023520 2:171890917-171890939 AATTTTCAACATAAAAATAAAGG + Intronic
942223635 2:173795566-173795588 AATAATCAAGATTTAAATCAGGG + Intergenic
942445740 2:176077033-176077055 AAATATTAATATTTAATTCAAGG - Intergenic
942445792 2:176077846-176077868 AAATATTAATATATAATTTAAGG - Exonic
943496829 2:188630773-188630795 AATCAAGAATATATAATTCAGGG + Intergenic
943904777 2:193485479-193485501 AATTATCAACATAATAGACAAGG + Intergenic
944072091 2:195682623-195682645 AATTATCAACAAAATATTCTAGG - Intronic
944180348 2:196885485-196885507 AAATATGAAAATATAATTAAAGG + Intronic
944324275 2:198385301-198385323 ATTTATTAACATATACTTAAGGG - Intronic
945402221 2:209397818-209397840 AATGAAAAACATCTAATTCAGGG + Intergenic
945426372 2:209709508-209709530 AATGATCTACATATCATTCAAGG + Intronic
945458674 2:210079293-210079315 AATTATCAAAATATAATTATCGG + Intronic
945548892 2:211194186-211194208 ATTTATTAACATTGAATTCACGG + Intergenic
945765718 2:213974626-213974648 AATTAACATCATATATTTCCTGG - Intronic
947710506 2:232311377-232311399 AATTATAAGCATCTAGTTCAAGG + Intronic
948704827 2:239782909-239782931 AATTTTCAAAATTTAATTTATGG + Intronic
1169352377 20:4879480-4879502 AATTTTAAAAATAAAATTCAGGG + Intronic
1169687499 20:8291570-8291592 AAATATCAACAAATAAATCATGG - Intronic
1172395115 20:34597899-34597921 AATGATTAACAAAAAATTCACGG + Intronic
1172552366 20:35811395-35811417 AAATAAGAACAAATAATTCAAGG - Intronic
1173533660 20:43791326-43791348 AATTATAAGCATATAATTGTAGG + Intergenic
1173979633 20:47213448-47213470 GATTATGACCATATCATTCATGG - Intronic
1177908852 21:27005612-27005634 AATTAAGAATATATAATCCATGG + Intergenic
1178954973 21:37013889-37013911 AATTATATAAATATAATACAAGG - Intronic
1179391786 21:40999938-40999960 AATAGTCTACATATAATTAAAGG - Intergenic
1184926653 22:47646054-47646076 AATTATTACCATATGATCCAGGG - Intergenic
949104570 3:188499-188521 AAGTTTCAACATATAAGTTAGGG + Intergenic
949716447 3:6937020-6937042 AATTTTGAACATATTATTTAGGG + Intronic
949965599 3:9353461-9353483 ACTTATCAACATGAAATTCAAGG + Intronic
951050400 3:18087097-18087119 ATCTATCAATATATATTTCATGG + Intronic
951050947 3:18092672-18092694 AATCATTGACATATAAGTCAGGG - Intronic
951490051 3:23260239-23260261 CATTATAAACATATAATAAATGG - Intronic
951623188 3:24629211-24629233 AATTATTAAAATTTAATACAAGG - Intergenic
952033428 3:29171926-29171948 AAATGTCAACATAAAGTTCACGG - Intergenic
952497237 3:33926499-33926521 AATTATAAAAAGATATTTCAAGG - Intergenic
952615233 3:35263135-35263157 AATCATCATCATTTCATTCAAGG + Intergenic
952725151 3:36575690-36575712 AAGTTTCAACATATAAATCTTGG - Intergenic
955546067 3:60031710-60031732 AATTATCAACAGGTAATTTGGGG + Intronic
956553970 3:70496983-70497005 AATGATCAAAATAGATTTCAGGG - Intergenic
957411966 3:79852961-79852983 AAATATCAGCGTTTAATTCAAGG - Intergenic
957874005 3:86121440-86121462 AATTATCAAACAATAATTAATGG + Intergenic
958599110 3:96271116-96271138 AATTATTAATATATTATACATGG - Intergenic
958793197 3:98676269-98676291 AATTATAAAAATAAAATTCTAGG - Intergenic
959078384 3:101775586-101775608 AATAATCAATATATATTTAAGGG - Intergenic
959484836 3:106914805-106914827 AAATAGCAACAAAAAATTCAGGG - Intergenic
959503763 3:107135826-107135848 AAATATAAATATATAATCCAAGG + Intergenic
960424920 3:117494775-117494797 AATATACAACATGTAATTCAGGG - Intergenic
962125927 3:132617636-132617658 AATTCTCAACATAGCAGTCAAGG + Intronic
963285540 3:143431308-143431330 GAAAATCAACAAATAATTCATGG - Intronic
963811356 3:149779858-149779880 AATTATCAACATTTCATTCTTGG - Intronic
964030471 3:152132960-152132982 AATAAGAAACATATAATTTATGG - Intergenic
964776549 3:160285352-160285374 AATAAACAACTTACAATTCAGGG + Intronic
965913819 3:173815974-173815996 AATTATTATAATATAATTTAAGG - Intronic
966414286 3:179673158-179673180 AATTCTCAAAATAAAACTCATGG - Intronic
966856732 3:184199192-184199214 AATAATTAACACACAATTCATGG + Intronic
970066484 4:12100245-12100267 ATTTCTCAAAAAATAATTCAAGG - Intergenic
970623877 4:17856145-17856167 AATTATCAATGTGTCATTCATGG - Intronic
970718094 4:18951901-18951923 AATTTTGAACATACTATTCAAGG - Intergenic
971147108 4:23990134-23990156 AATTATGTATATATAATCCATGG + Intergenic
971615592 4:28786929-28786951 AAAAATAAACATATAATTCAGGG - Intergenic
972051955 4:34747010-34747032 ATTTATCAATTTATAATTAATGG + Intergenic
972728177 4:41764857-41764879 AATTTTCAACCTATAAATGAGGG + Intergenic
972932896 4:44096375-44096397 AATTATGAAAATATAATTCTTGG - Intergenic
973785484 4:54328795-54328817 ATTTATCATCACAGAATTCAGGG - Intergenic
975219707 4:71800019-71800041 AACAATCAACACACAATTCATGG + Intronic
976779517 4:88743230-88743252 AATTATCCACATTTAATTAATGG + Intronic
977179083 4:93851687-93851709 AATTTTGAACATACAATTGAAGG + Intergenic
977186603 4:93946098-93946120 AATTCTCAAACTTTAATTCATGG - Intergenic
977436102 4:96997218-96997240 AAAAATCAACATTTTATTCAAGG + Intergenic
977567072 4:98591687-98591709 AATTATTAACATTAATTTCATGG + Intronic
977648395 4:99440488-99440510 ATTTATCAACCTAAAATACATGG + Intergenic
977789192 4:101078627-101078649 AACTATCAGCTTATAATTCTAGG + Intronic
978151308 4:105438888-105438910 AATTATCTATATAAAATTAAAGG - Intronic
978697003 4:111593900-111593922 AATAATCAACATAAAAATTACGG + Intergenic
979023933 4:115543622-115543644 AATTTTGAATAAATAATTCATGG + Intergenic
979070385 4:116196534-116196556 AAGTATCAACATAAATTTCTGGG + Intergenic
979429613 4:120612807-120612829 AATTATCAAAATACAATTTCAGG - Intergenic
979506364 4:121502355-121502377 AATTATCAATAAATATTTGATGG + Intergenic
979895530 4:126151341-126151363 AATTGCCAACATATATTTAATGG - Intergenic
980842242 4:138277937-138277959 AATTCTCCACATATATGTCATGG + Intergenic
981132768 4:141176316-141176338 ATGTTTCAACATATAAATCATGG + Intronic
981316758 4:143348232-143348254 AATTATCAACATATAATTCAGGG - Intronic
982142306 4:152336997-152337019 ACTTATGAAAATATAAATCATGG + Intronic
982416279 4:155136329-155136351 AATTATAAACAAATATTTCATGG - Intergenic
982667415 4:158282712-158282734 AATTATGCTAATATAATTCATGG - Intergenic
983121273 4:163888196-163888218 AATTATCAACATATACACCATGG + Intronic
983407913 4:167354354-167354376 AATTATCAACATTTTAACCACGG + Intergenic
983579762 4:169296550-169296572 AATTACCAACATAATATTGAAGG + Intergenic
983880762 4:172929848-172929870 AATTATCAAAACATAAATCCAGG - Intronic
984341739 4:178465832-178465854 TTTTATCATCCTATAATTCAAGG + Intergenic
984396232 4:179203543-179203565 ACATATAAACATATAATACAGGG + Intergenic
984863681 4:184262048-184262070 AATTAACAACATAATATTGATGG + Intergenic
985029322 4:185773014-185773036 AAGTTTCAACGTAAAATTCAGGG + Intronic
985104685 4:186488953-186488975 AATTATCCACAAAGAATTTAGGG + Intronic
985349445 4:189042172-189042194 AATGATGCACCTATAATTCAAGG + Intergenic
987527258 5:19069049-19069071 AATTATCGAAATATAATAGAAGG - Intergenic
987567679 5:19614297-19614319 TATTGTGAACATATAATTGAGGG + Intronic
987698268 5:21360357-21360379 AATTATCTGAATATATTTCAGGG - Intergenic
987964065 5:24849764-24849786 TATTATCTGCATATATTTCATGG + Intergenic
987994462 5:25257859-25257881 AATTATCAATATATGAATAATGG - Intergenic
987994464 5:25257893-25257915 AATTATCAATATATGAATAATGG - Intergenic
988147247 5:27326311-27326333 AATTATCACTATCTAATTCCAGG - Intergenic
988194872 5:27992108-27992130 AATGATCAATATATATTTTATGG - Intergenic
988322332 5:29714297-29714319 AATATTCAACATAGAATTAAAGG + Intergenic
988332116 5:29855430-29855452 ATTTATCAACCTACAATTCTGGG - Intergenic
988648290 5:33120614-33120636 CATTATGCACATTTAATTCAAGG + Intergenic
988754386 5:34231175-34231197 AATTATCTGAATATATTTCAGGG + Intergenic
988800012 5:34687804-34687826 AGCTGTCAAAATATAATTCACGG - Intronic
988827868 5:34957760-34957782 AATCATCACCAGAGAATTCACGG - Exonic
989096053 5:37782226-37782248 AATTAGCACCATTTAATCCAGGG - Intergenic
989477309 5:41889255-41889277 AATTTGTAACATATAATTTATGG - Intergenic
990345721 5:54869097-54869119 CATTATCAAAATCTAAGTCAGGG + Intergenic
990717526 5:58654947-58654969 AATTATGCACATATAATTTTAGG + Intronic
991369786 5:65906285-65906307 GATAATCAACAAGTAATTCATGG - Intergenic
991742163 5:69692017-69692039 AATTATCTGAATATATTTCAGGG + Intergenic
991755530 5:69863191-69863213 AATTATCTGAATATATTTCAGGG - Intergenic
991793737 5:70271757-70271779 AATTATCTGAATATATTTCAGGG + Intergenic
991821554 5:70567321-70567343 AATTATCTGAATATATTTCAGGG + Intergenic
991834857 5:70738339-70738361 AATTATCTGAATATATTTCAGGG - Intergenic
991886115 5:71271289-71271311 AATTATCTGAATATATTTCAGGG + Intergenic
992042879 5:72854111-72854133 AATTATTAACAGGTAATTTAAGG + Intronic
992837969 5:80658929-80658951 AATTATTAAGATATAGTTCTTGG + Intronic
993096093 5:83479871-83479893 AATGATCATCTTTTAATTCAAGG + Intronic
993262176 5:85672319-85672341 AATTATCTACCTATATTTTAAGG - Intergenic
993264236 5:85702162-85702184 AATTATAAACATATAATCAAGGG - Intergenic
993402459 5:87470690-87470712 AATTATTAACATTAATTTCATGG - Intergenic
993498399 5:88634442-88634464 AATTGCCAACCTATAGTTCAGGG - Intergenic
993697833 5:91082846-91082868 AAATAACAACAAATAATACATGG - Intronic
993741158 5:91541384-91541406 TTTTATCACCATATAATTCTAGG + Intergenic
993855412 5:93068003-93068025 AATTACAAACATGTACTTCAGGG + Intergenic
994283167 5:97930621-97930643 AATTATCAAAATGTATTTTAAGG - Intergenic
994797764 5:104327672-104327694 AAGTATTCCCATATAATTCATGG - Intergenic
994807787 5:104474235-104474257 CATTATAAACATGTGATTCATGG - Intergenic
994953187 5:106492346-106492368 ATTTATCAACATATCTTTTATGG - Intergenic
995171998 5:109125163-109125185 AATTCTAAATATTTAATTCATGG - Intronic
995637747 5:114214356-114214378 AATTATCATCATCTAAGTCATGG - Intergenic
995647961 5:114334527-114334549 AATTATGAACATGTAATAAAGGG - Intergenic
995823082 5:116260210-116260232 ACTTATCAACATATTATGAAGGG + Intronic
995907062 5:117137363-117137385 AAATATCTACAAATAATTCTGGG + Intergenic
996281427 5:121733931-121733953 AATTACAAACCTATAGTTCAAGG - Intergenic
996293734 5:121886806-121886828 AAATATAACTATATAATTCAGGG + Intergenic
997069694 5:130606936-130606958 ATTTTTCAAAATATAATACATGG + Intergenic
999838540 5:155400399-155400421 AATTATCCACATAGAAGCCAAGG + Intergenic
1001392382 5:171389220-171389242 AATGAACAAGATAAAATTCACGG - Intronic
1002990910 6:2237851-2237873 AATAATCAACAAATAAATAAAGG + Intronic
1002999309 6:2316557-2316579 AATTAAGAACCTATAATTGAAGG - Intergenic
1003501743 6:6708836-6708858 GATCTTCAACTTATAATTCAAGG - Intergenic
1004153510 6:13144976-13144998 ATATATAAACATCTAATTCAAGG + Intronic
1004628237 6:17396940-17396962 AATGATTAACACAAAATTCAGGG - Intronic
1004751880 6:18570088-18570110 AATTATTATCATATAATTCAAGG - Intergenic
1005552571 6:26938029-26938051 AATTATCTGAATATATTTCAGGG + Intergenic
1005659800 6:27985290-27985312 AATGATAAACATAAAATTTAGGG + Intergenic
1005719688 6:28589208-28589230 AACTGTCAAAATAAAATTCAGGG - Intronic
1006663774 6:35673749-35673771 AATTATTATCATATAGTTCCTGG + Intronic
1007190137 6:40008166-40008188 AGTTGTCAGCATATAATTGATGG + Intergenic
1007226562 6:40319616-40319638 AATTATCAATAAATTCTTCATGG - Intergenic
1008094291 6:47322932-47322954 AATTATCAATGTAGCATTCAAGG + Intergenic
1009183489 6:60546646-60546668 ATTTAGCAACATATAATTAAAGG + Intergenic
1009548018 6:65047171-65047193 AAATAACAATTTATAATTCAAGG - Intronic
1009799990 6:68524948-68524970 AAATATAAAAACATAATTCAAGG - Intergenic
1010016499 6:71110398-71110420 CATTTTCCACATATAATCCATGG - Intergenic
1010542310 6:77106999-77107021 TAATTTCATCATATAATTCATGG + Intergenic
1010991181 6:82482042-82482064 AAATAACAATATATACTTCATGG - Intergenic
1011504220 6:88023352-88023374 AATTAAGAATATATAATTTATGG - Intergenic
1012330378 6:97978419-97978441 ACTTATGAACATATAATAGAGGG + Intergenic
1012716369 6:102677695-102677717 AATTATCAGCATTGAGTTCAGGG - Intergenic
1012915166 6:105162342-105162364 AATTAGCTACATATTTTTCAAGG + Intronic
1013499823 6:110737800-110737822 AACTATCACCATATATTGCAAGG + Intronic
1013692007 6:112656954-112656976 AATTATTAAAATTTGATTCACGG - Intergenic
1013709595 6:112880939-112880961 AAATATCAACATGTCTTTCAAGG + Intergenic
1013709661 6:112881707-112881729 GATTATCAATACATAAATCATGG + Intergenic
1014385085 6:120790825-120790847 AATTATCAAAATATAAAGCAAGG + Intergenic
1014652569 6:124058597-124058619 AATAGTCAACATCTAATTCATGG + Intronic
1014664252 6:124216718-124216740 AATTATTAACATTCAAGTCATGG - Intronic
1015035421 6:128647723-128647745 AAATATCAACTTCTACTTCATGG + Intergenic
1015036676 6:128664281-128664303 AGTTATCAACAGAACATTCAAGG + Intergenic
1015086442 6:129298535-129298557 AATTAGCAGCATATAAATCAAGG - Intronic
1015652842 6:135481854-135481876 AATTGTCAACCTAAAATTCTCGG - Intronic
1015957804 6:138616357-138616379 AATGAACAACAGTTAATTCAAGG + Intronic
1015989157 6:138917785-138917807 AATTAACTACAAATAAATCATGG + Intronic
1016276597 6:142360503-142360525 AATTATTGTCATATAATTCTAGG + Intronic
1016278932 6:142390211-142390233 AACTATAAACATATAATTAATGG + Intronic
1017200223 6:151745158-151745180 AATATTCAACATAAAATTCCAGG + Intronic
1017252798 6:152300011-152300033 TATTATCTACATTTAATACATGG + Intronic
1018939434 6:168299134-168299156 AATTTTCCACATATAATTTAGGG - Intronic
1019085710 6:169474490-169474512 GATGATAAACATTTAATTCATGG + Intronic
1020711890 7:11616943-11616965 AATTATCATCTTATTATTCAAGG + Intronic
1020880504 7:13756493-13756515 AATAATCAATATATTAGTCAAGG - Intergenic
1020960050 7:14790932-14790954 ATTGATCAATATACAATTCATGG - Intronic
1021409482 7:20313864-20313886 AATCAGCAACATGTAAGTCAAGG + Intergenic
1021965083 7:25910012-25910034 ATTAATAAAAATATAATTCAAGG + Intergenic
1022422262 7:30234760-30234782 AAATAATCACATATAATTCAGGG - Intergenic
1022697170 7:32718993-32719015 AAATATCAACTTATAACACAAGG + Intergenic
1022753923 7:33263897-33263919 AATTATCAATACATAATCTATGG - Intronic
1023127500 7:36970269-36970291 GATTACCAAGAAATAATTCATGG - Intronic
1023476386 7:40583481-40583503 AAATATCATCATACAATTCCAGG - Intronic
1025623558 7:63197158-63197180 AATTATCAAAATATATTGCAAGG - Intergenic
1027007854 7:74711088-74711110 TATTATCAATATAACATTCAAGG + Exonic
1027580758 7:79992116-79992138 AATTTTCAACATATAAATCCTGG - Intergenic
1027896875 7:84055727-84055749 AAGAATCAACATATAATTTGGGG - Intronic
1028072078 7:86462523-86462545 AAGCATCTATATATAATTCAAGG - Intergenic
1028236428 7:88368101-88368123 ACTTATTAACATAGAAATCATGG - Intergenic
1028320726 7:89456788-89456810 AATTCTCAACATATCATTATTGG - Intergenic
1029829611 7:103242846-103242868 AAATATCAACTTATAACACAAGG + Intergenic
1029882526 7:103831323-103831345 ATTGAACATCATATAATTCAAGG + Intronic
1030813932 7:114010867-114010889 AATTAAGAACACAAAATTCAGGG + Intronic
1031332140 7:120479091-120479113 CAATATCAACATAAAATGCATGG + Intronic
1031531075 7:122877856-122877878 AATTATCAACATTTTACTGAAGG + Intronic
1031662660 7:124445417-124445439 AAATTTCAACATATAATACAAGG - Intergenic
1031700462 7:124918697-124918719 AATTGTAAACATGTAATTCTGGG - Intronic
1031901504 7:127416070-127416092 AATTCTCTAGATAGAATTCAGGG + Intronic
1032690983 7:134286353-134286375 TATTATCAAAGGATAATTCAGGG + Intergenic
1033959848 7:146901171-146901193 ACTTATCAAAATATAAATAAAGG + Intronic
1034100730 7:148448189-148448211 ATTTATCAACATTGAACTCATGG + Intergenic
1034172936 7:149076782-149076804 AATTTTCAAAATATAATTTGAGG - Intronic
1034381125 7:150693645-150693667 AATTAACAACATATGATCAAAGG - Intergenic
1034945372 7:155258601-155258623 AATTATATACATATAAAACAAGG - Intergenic
1036997335 8:13673640-13673662 AATTTCCATCATATAATACAAGG + Intergenic
1037021167 8:13972763-13972785 AATTATAATCATAAAATACAGGG - Intergenic
1037193806 8:16161639-16161661 AATGATAAACACAAAATTCAGGG - Intronic
1037277611 8:17198302-17198324 AATTATAAAAATATAAATTATGG - Intronic
1039003325 8:33006222-33006244 AGTTATCAGCATATAATATAAGG - Intergenic
1039169073 8:34720945-34720967 AATTATACCCATATAATGCAAGG - Intergenic
1041149897 8:54920522-54920544 AATTATCTACACATATTTAATGG - Intergenic
1041436454 8:57847388-57847410 CATTGTCAACAAATATTTCATGG + Intergenic
1042300269 8:67272140-67272162 AATTATAAATATATGGTTCAGGG - Intronic
1042418482 8:68556444-68556466 AATTATCAAGATACTAATCAGGG - Intronic
1043126188 8:76398876-76398898 AATTAACAACATGTATTTCAAGG - Intergenic
1043188718 8:77189724-77189746 AATTATGAGCTTATCATTCATGG + Intergenic
1043565859 8:81546683-81546705 AAATTTCAAAATATAATTTAAGG + Intergenic
1043697537 8:83239602-83239624 AATTATAAACATTCAATTAAAGG - Intergenic
1043711371 8:83422925-83422947 AATACTCAAAATATAAATCAAGG + Intergenic
1044267413 8:90199630-90199652 AAATATCAACATTTAGATCAGGG - Intergenic
1044337877 8:91009458-91009480 ATTTAACAAAATATATTTCATGG - Intronic
1045331460 8:101159099-101159121 AGTTATCAGCATATGAATCATGG + Intergenic
1045851590 8:106705624-106705646 AATTAGCAACTTACATTTCATGG + Intronic
1046136430 8:110033418-110033440 AATAAATAAAATATAATTCATGG + Intergenic
1046209955 8:111058684-111058706 TAATAGGAACATATAATTCAAGG - Intergenic
1046316805 8:112513588-112513610 AATTACCAAAATATAATACAGGG + Intronic
1046356839 8:113097477-113097499 ACTTAACAACATATAAGTCCTGG - Intronic
1047787068 8:128163692-128163714 AATTGTCAACATATCATACTTGG + Intergenic
1047846385 8:128810179-128810201 AAATAACAACATATAATTTTGGG - Intergenic
1049893702 9:94811-94833 CATTATAAACACATAATACATGG - Intergenic
1050254318 9:3778339-3778361 ATTTATTAAAATATAATTCAAGG - Intergenic
1051168437 9:14292149-14292171 AATTATCAAAAAATAATGAAAGG - Intronic
1052155307 9:25180491-25180513 AAATATTAACATATAAATAAAGG + Intergenic
1052225839 9:26084862-26084884 CTTTTTCCACATATAATTCAAGG - Intergenic
1052304795 9:26995523-26995545 AATTTTCTTCACATAATTCATGG + Exonic
1053608783 9:39688535-39688557 AACCATCAAAATATAAATCATGG - Intergenic
1053866629 9:42444901-42444923 AACCATCAAAATATAAATCATGG - Intergenic
1054244741 9:62653863-62653885 AACCATCAAAATATAAATCATGG + Intergenic
1054558868 9:66688406-66688428 AACCATCAAAATATAAATCATGG + Intergenic
1054693458 9:68336516-68336538 CATTATAAACACATAATACATGG + Intronic
1055349130 9:75367004-75367026 ATATATATACATATAATTCAAGG - Intergenic
1056177663 9:84051156-84051178 AATATTAAACATAAAATTCAGGG - Intergenic
1057541853 9:95981535-95981557 AAATATCAAAATACAATTTAAGG - Intronic
1058615745 9:106825595-106825617 AATTAAAAACATATTTTTCATGG - Intergenic
1059050163 9:110915928-110915950 AATTATCAATATGAAAATCATGG + Intronic
1059169061 9:112107690-112107712 TACTTTCAACATATAATTCAAGG + Intronic
1059648816 9:116295246-116295268 ACTTTTCAATATATAATTCTGGG - Intronic
1060251059 9:121987138-121987160 AATAATCAACATAAAATTCAGGG + Intronic
1061307844 9:129742593-129742615 AAATATCAACACATACTTTAAGG - Intronic
1186753853 X:12649405-12649427 ATTTATGAAGATATGATTCAGGG + Intronic
1186921354 X:14284468-14284490 GATTATCAATACATACTTCAGGG - Intergenic
1188188614 X:27146535-27146557 AAATATGAACATATAATCCTTGG + Intergenic
1188801995 X:34543808-34543830 AAGTTTCAACATATGATTCAGGG + Intergenic
1188802917 X:34553726-34553748 TATTATAAAAATATAATTCCAGG - Intergenic
1189022500 X:37355560-37355582 TGTTATGAACATATAATTGATGG + Intronic
1191082403 X:56526777-56526799 GATTATCAACCTATAATGGAAGG - Intergenic
1191778184 X:64841247-64841269 AATTACCAACAAAAAATTCGAGG - Intergenic
1191789603 X:64955495-64955517 GATTATGAACTTAAAATTCAAGG - Intronic
1194195481 X:90886325-90886347 GATTATGAACCTAAAATTCAAGG - Intergenic
1194541887 X:95183333-95183355 AGATTTCAAGATATAATTCATGG - Intergenic
1194587165 X:95749746-95749768 AAAAAACAACTTATAATTCATGG - Intergenic
1195436481 X:104849708-104849730 AATTGTCAACATATTATTTTTGG - Intronic
1195799917 X:108696636-108696658 AATTTTCATCTTATAATTCTTGG - Exonic
1195945467 X:110206039-110206061 AATAATCAAGATATATTTTAGGG - Intronic
1197040645 X:121931877-121931899 AAATATAAGAATATAATTCAAGG + Intergenic
1197566672 X:128096303-128096325 AGTTTTCAACAAATAATTCTGGG - Intergenic
1198172059 X:134116829-134116851 CCTTAAAAACATATAATTCATGG - Intergenic
1198210345 X:134510413-134510435 TATTATCACCAAATAATTCCAGG + Intronic
1198718585 X:139590381-139590403 AGTTATAAACATCTAATTCATGG + Intronic
1199119299 X:144032034-144032056 AATTATTAACATATAAGTCAAGG + Intergenic
1200324887 X:155226496-155226518 ATTTATCAACATAAAAGTTAAGG + Intronic
1201308898 Y:12576762-12576784 AATTAGCACCATTTAATCCAGGG + Intergenic
1202071368 Y:20995062-20995084 AATTATGAACATATGAGGCATGG - Intergenic