ID: 981316759

View in Genome Browser
Species Human (GRCh38)
Location 4:143348233-143348255
Sequence AAATTATCAACATATAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 637
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 570}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981316759_981316762 18 Left 981316759 4:143348233-143348255 CCTGAATTATATGTTGATAATTT 0: 1
1: 0
2: 5
3: 61
4: 570
Right 981316762 4:143348274-143348296 CATTTCTCATTCCAGATCTATGG No data
981316759_981316763 27 Left 981316759 4:143348233-143348255 CCTGAATTATATGTTGATAATTT 0: 1
1: 0
2: 5
3: 61
4: 570
Right 981316763 4:143348283-143348305 TTCCAGATCTATGGCTCTAATGG 0: 1
1: 0
2: 1
3: 11
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981316759 Original CRISPR AAATTATCAACATATAATTC AGG (reversed) Intronic
902356205 1:15902754-15902776 ATATAATCAATATATAATTTGGG - Intronic
903418144 1:23198815-23198837 AAATTATAAATATAAAATTCAGG + Intergenic
903937069 1:26903307-26903329 AAATGATTAACATAAAATCCAGG + Intronic
903975314 1:27145962-27145984 AAAATACCAACATATAATCACGG + Intronic
904229815 1:29059298-29059320 AACTTTTCAACATATAGTACAGG - Intronic
905032248 1:34893686-34893708 AGCTTATCAAAATATAATTATGG - Intronic
905485130 1:38290666-38290688 TAAGTACCAACATTTAATTCTGG - Intergenic
906235391 1:44204560-44204582 AATTTATTAACATTTTATTCAGG + Intergenic
908134384 1:61115279-61115301 AAGTTATCAATATATATTTGCGG - Intronic
908565389 1:65350618-65350640 AAATTACCGACATATCCTTCTGG + Intronic
908906460 1:69017581-69017603 AAATTTTGAAAATATAACTCTGG - Intergenic
909043080 1:70676804-70676826 AAATTATAAACTTATACTTTAGG - Intergenic
909169189 1:72272897-72272919 AAAAGAGCAACATTTAATTCTGG + Intronic
909226414 1:73030094-73030116 AATTTCTGAAAATATAATTCTGG + Intergenic
909327152 1:74364928-74364950 AATTTATTATCTTATAATTCTGG - Intronic
909332994 1:74437395-74437417 AAATTAACAAAATATATCTCAGG + Intronic
909509137 1:76431343-76431365 AAATTATCAAATTTTAATTCTGG - Intronic
909600640 1:77457898-77457920 AATTTATCATCTTATAGTTCTGG + Intronic
909865894 1:80670774-80670796 AGATTCTAAACATATCATTCTGG + Intergenic
909911926 1:81270574-81270596 AAATTATATTCATATAATTTGGG + Intergenic
910649783 1:89554073-89554095 AAATTTTCAAGATTTAACTCAGG - Intronic
910913420 1:92262201-92262223 CAATTAACAACACATGATTCAGG + Intronic
911421827 1:97652603-97652625 ATATTATCAAGATTTCATTCAGG + Intronic
911475636 1:98368753-98368775 AAATTCTTAACCTATATTTCTGG + Intergenic
912221298 1:107679966-107679988 AAAGTATCAACTTATAATCTTGG - Intronic
912432137 1:109633912-109633934 AAAATATCTACATATATCTCAGG - Intergenic
913085142 1:115429871-115429893 AAGATATCAACATATAATTTGGG + Intergenic
913427729 1:118752943-118752965 AAATAATCAACATATGCTTGAGG + Intergenic
913430219 1:118781840-118781862 AGATTTTCAACAAATAGTTCTGG - Intergenic
913480388 1:119282666-119282688 AAATTATATACATATAATAATGG + Intergenic
915989118 1:160495383-160495405 ATGTTATCAACATAAAATTATGG - Intronic
917000347 1:170351109-170351131 AATTTATTAACAAATATTTCAGG - Intergenic
917050630 1:170918324-170918346 AATTTATTTTCATATAATTCTGG - Intergenic
917349540 1:174062749-174062771 AAATTATGAAAATATAATTCTGG - Intergenic
917947448 1:179989712-179989734 AAATTCGCAAGATAGAATTCAGG - Intronic
918956543 1:191216232-191216254 AAATTATCAACTGATAATATTGG - Intergenic
919337642 1:196259101-196259123 AAAATATTAAAACATAATTCAGG + Intronic
920628541 1:207628033-207628055 AAATTTTCAACATATAAATTTGG + Intronic
920638687 1:207730215-207730237 AAATTTTCAACATATAAATTTGG + Intronic
920753001 1:208699706-208699728 ACTTTATCTACAAATAATTCTGG + Intergenic
921224154 1:213000588-213000610 AAATCATGCACAGATAATTCTGG + Intronic
923300959 1:232640351-232640373 AAGTTCCCAAAATATAATTCTGG - Intergenic
923703005 1:236317790-236317812 AAAGTATCATCATAAAATACAGG + Intergenic
923794970 1:237144916-237144938 AAATTATAAACACAAAATTCAGG - Intronic
923908434 1:238412253-238412275 AAATTAACATCATATATTTCTGG - Intergenic
924426405 1:243954240-243954262 AAGTTTTCAAAATAAAATTCAGG + Intergenic
1063171184 10:3511341-3511363 AATTTATCAACCTATAGTTCTGG - Intergenic
1063827535 10:9914861-9914883 AAATCCTGAAAATATAATTCTGG - Intergenic
1064542997 10:16424139-16424161 GAATAATTAACATAAAATTCAGG + Intergenic
1064836881 10:19542981-19543003 ATATTATTAACAAATAATACAGG - Intronic
1064970099 10:21056818-21056840 AAATTATAACCACAAAATTCAGG + Intronic
1065387914 10:25151754-25151776 AAATTATAAACACAGGATTCAGG - Intergenic
1065697764 10:28395592-28395614 AAATTATCAACAGGTGATTCTGG + Intergenic
1066203463 10:33163913-33163935 AAATTATCTTGATATATTTCTGG + Intergenic
1067405161 10:46015858-46015880 AAATTATAAACTAATATTTCTGG + Intronic
1067663393 10:48253218-48253240 AACTTTTCAACAAATAGTTCTGG + Intronic
1068362288 10:55993681-55993703 AAATTATCCAACTATAATTGTGG + Intergenic
1069385079 10:67876905-67876927 AAAATATCTACATATAAATACGG - Intergenic
1073843939 10:107530698-107530720 AAATGAGCAAAATATAATACTGG + Intergenic
1073912218 10:108359605-108359627 CAATGATGACCATATAATTCAGG + Intergenic
1074068542 10:110041922-110041944 AAATTATCCACATATTTTTTGGG - Intronic
1074488902 10:113920229-113920251 ACATTATCATAAAATAATTCTGG - Intergenic
1075639509 10:124054851-124054873 AAATAATCAACATATCAATTTGG - Intronic
1076484424 10:130806979-130807001 AGGTCCTCAACATATAATTCTGG - Intergenic
1076939891 10:133597066-133597088 AAATTCTCCAAATATAATTGTGG + Intergenic
1076988180 11:254266-254288 AAATTCTGAAAATATATTTCTGG + Intergenic
1077547200 11:3178876-3178898 AAATTCCCAAAATATAATTCAGG + Intergenic
1077595797 11:3530269-3530291 TAACTATTAAAATATAATTCAGG + Intergenic
1077666082 11:4110854-4110876 AAATGAGCAACATATACATCAGG - Intronic
1079460980 11:20677702-20677724 AAATTATCAATCCATAATTGGGG + Intronic
1079527845 11:21412577-21412599 AAATGTTCAACATCTAACTCTGG - Intronic
1079717439 11:23765967-23765989 GAATTATTAACATATAAATATGG + Intergenic
1080116461 11:28626628-28626650 AAGATATCAACATATAATCTGGG + Intergenic
1080273498 11:30476157-30476179 ATATTTTCAACCTATAAATCTGG - Intronic
1080350036 11:31373373-31373395 AAATTTTCAACAAATGATGCTGG - Intronic
1080605812 11:33864139-33864161 AATTTCTCATCATATAATACTGG + Intronic
1080769903 11:35330899-35330921 AACTTATTATCATATAGTTCTGG - Intronic
1080993754 11:37575757-37575779 AAAATATGAATATATATTTCTGG - Intergenic
1081372684 11:42323471-42323493 AAATTATCTACAAAGACTTCAGG - Intergenic
1081513275 11:43798609-43798631 ATATTAACAACATACAATTTTGG + Intronic
1081942749 11:46958455-46958477 AAAATATCCACATATAACTTTGG - Intronic
1083042049 11:59698196-59698218 AAATTATTGGCATATAATTGTGG + Intergenic
1084821148 11:71691779-71691801 TAACTATTAAAATATAATTCAGG - Intergenic
1085008589 11:73118473-73118495 AACTTTTCAGTATATAATTCTGG + Intronic
1085931516 11:81088976-81088998 TCTTTATCAACATGTAATTCTGG - Intergenic
1085966422 11:81533541-81533563 AATTTATTATCTTATAATTCTGG - Intergenic
1086408454 11:86520008-86520030 AAATAATCAAAATATTCTTCAGG - Intronic
1086965740 11:93026190-93026212 AAATTCTGACCATATATTTCAGG - Intergenic
1087260028 11:96001076-96001098 ACATTATAAACATATGATTGGGG - Intronic
1087444363 11:98229216-98229238 AAGTTTTCAACATATAATTTTGG + Intergenic
1087508283 11:99056551-99056573 AAATTATTAAAATATGATGCTGG - Intronic
1087580563 11:100046388-100046410 AGATTATGAACACATATTTCAGG - Intronic
1087870460 11:103287641-103287663 AAATTAAAAACAAATAATTCAGG - Intronic
1088112965 11:106282980-106283002 AAAGTTTCAAGATATAAATCTGG - Intergenic
1088171010 11:106996762-106996784 AAATCATCAACATACTACTCAGG + Intronic
1088220096 11:107561400-107561422 AAATTATAAACACAAAATTCAGG + Intronic
1088530433 11:110802258-110802280 AAATTCACAACATTTATTTCTGG - Intergenic
1088554184 11:111045010-111045032 AAATTCTTCCCATATAATTCTGG + Intergenic
1089151890 11:116370832-116370854 AAATTAGCAACCTTGAATTCTGG - Intergenic
1089383757 11:118054786-118054808 AAATCCTGAAAATATAATTCTGG - Intergenic
1090738608 11:129635120-129635142 AAATAATCACTATATAATACTGG - Intergenic
1091085835 11:132720924-132720946 AAAATTACAACTTATAATTCTGG + Intronic
1091477574 12:791264-791286 AAATTATGAACACATAATAAAGG + Intronic
1092421963 12:8339040-8339062 TAACTATTAAAATATAATTCAGG + Intergenic
1092900682 12:13056843-13056865 GAATAATCAACACAAAATTCAGG - Intronic
1093245511 12:16731222-16731244 AAATAATAAATAAATAATTCTGG - Intergenic
1093376954 12:18440913-18440935 AAATTATCAACATATACGTAAGG + Intronic
1093517613 12:20008566-20008588 AAATGCTGAAAATATAATTCTGG + Intergenic
1093649880 12:21630666-21630688 AAAACATCAACTTATATTTCAGG - Intergenic
1093653433 12:21670184-21670206 AAATCTTGAAAATATAATTCTGG - Intronic
1093841752 12:23911227-23911249 AGATTATCCACATGTATTTCTGG - Intronic
1093900821 12:24629980-24630002 AAAATATCAACAAAAAATCCAGG - Intergenic
1095260385 12:40092414-40092436 AAATCATCCAGATTTAATTCTGG - Intronic
1095383882 12:41627702-41627724 AAATTACCTACATAACATTCTGG + Intergenic
1096949066 12:55445734-55445756 AAATTATAAATATATAAATTAGG + Intergenic
1097481265 12:60128753-60128775 GAATTAGAAACATATAATTGTGG + Intergenic
1097556330 12:61143370-61143392 ATATTATCAAAATATAAAACTGG + Intergenic
1098067768 12:66637523-66637545 AAATTATTAACAAAAATTTCTGG - Intronic
1098129882 12:67339149-67339171 AAATTTTAAAAATACAATTCAGG - Intergenic
1098709317 12:73735244-73735266 AAATTTGCAACAAATAATTAAGG - Intergenic
1099219093 12:79891190-79891212 AAGTTAAGAATATATAATTCTGG + Intronic
1099722341 12:86380850-86380872 AAATCTTGAAAATATAATTCAGG + Intronic
1100286353 12:93170486-93170508 CAATTGTCAACATCTATTTCTGG + Intergenic
1101363821 12:104053081-104053103 AAGTTAACAGCACATAATTCTGG - Intronic
1101484461 12:105138989-105139011 GAATGATAAACATAAAATTCAGG - Intronic
1102723883 12:115041532-115041554 AAATTATCAAGAAACATTTCAGG - Intergenic
1103430688 12:120882946-120882968 ATTTTATCAACATATAGTTCTGG + Intronic
1104570648 12:129922325-129922347 CAATTATCAACATATTCTGCTGG - Intergenic
1105235811 13:18552486-18552508 AAATTATCAACAGAGAAAACAGG - Intergenic
1105514769 13:21079118-21079140 AAATTATTAACATCAAATTTGGG + Intergenic
1105763332 13:23533203-23533225 AAATAATCACCATATTTTTCTGG + Intergenic
1105929081 13:25034925-25034947 AAATCCTGAAAATATAATTCTGG + Intergenic
1106835663 13:33632382-33632404 AAACTATAACTATATAATTCTGG - Intergenic
1107453169 13:40530636-40530658 AAATGTTCAAAATCTAATTCTGG + Intergenic
1107572439 13:41677021-41677043 AAATCTTGAAAATATAATTCTGG - Intronic
1107732330 13:43360766-43360788 AAATTAAAAAAATAAAATTCTGG + Intronic
1108474832 13:50804271-50804293 AAAATATAAACATTTAATACAGG - Intronic
1108697488 13:52915341-52915363 AATTTATTATCTTATAATTCTGG - Intergenic
1108932528 13:55844581-55844603 AAATTATAAAAATATATTTTTGG + Intergenic
1108995080 13:56720745-56720767 AGTTTATCTACATTTAATTCTGG + Intergenic
1109450770 13:62511960-62511982 AAATGATAAACATAGAATTCAGG - Intergenic
1109615305 13:64827400-64827422 AAAATAGAAACATATAATTTCGG + Intergenic
1109800278 13:67368357-67368379 AAGTTATCACCATATAAATGGGG + Intergenic
1109928351 13:69178514-69178536 AAATTATAAACCTATTATTTAGG + Intergenic
1109947176 13:69451062-69451084 TAATCATTAACATATAATTTGGG + Intergenic
1110134918 13:72054808-72054830 ATATTATCAACATATGAATTTGG + Intergenic
1110618848 13:77572246-77572268 ACATTGACAACATATAATTGTGG + Intronic
1111044160 13:82793466-82793488 AAATTCTGCAAATATAATTCAGG + Intergenic
1111187651 13:84761036-84761058 AAATAATCTAGATGTAATTCAGG + Intergenic
1111286351 13:86098095-86098117 AAATTATGAAGATGCAATTCAGG + Intergenic
1111310737 13:86480872-86480894 AAATTGTCCAGGTATAATTCTGG + Intergenic
1111517450 13:89353208-89353230 GAATTATTAGCACATAATTCTGG - Intergenic
1111595911 13:90410312-90410334 AAATTATCAACAAATAGTAAAGG + Intergenic
1111726721 13:92019918-92019940 AAATTATTATCTTATAATTCTGG + Intronic
1112639702 13:101259047-101259069 AAATTTTCAACAAATATTTATGG - Intronic
1112657185 13:101463471-101463493 CAATTATGATCATATAAATCAGG - Intronic
1112663954 13:101546209-101546231 AAATCATAAACATAAAATTCAGG + Intronic
1113140044 13:107137631-107137653 AAATCCTAAACATTTAATTCGGG - Intergenic
1114446162 14:22789959-22789981 AATTTATCATCTCATAATTCTGG - Intronic
1114513368 14:23280579-23280601 AAATTGTCAACAGAATATTCTGG - Intronic
1115032197 14:28810122-28810144 AAATTTTCAATATATGTTTCTGG - Intronic
1115894089 14:38064663-38064685 AATTTATCGACATATATTTATGG + Intergenic
1116104526 14:40484521-40484543 ACATTAACAAAATAAAATTCAGG - Intergenic
1116224980 14:42138758-42138780 AATTTATCAATATATTATTCAGG - Intergenic
1116549988 14:46224717-46224739 AAATTATATATATATAATTTTGG - Intergenic
1117059512 14:51947651-51947673 AATTTATTATCTTATAATTCTGG - Intronic
1117291815 14:54341877-54341899 AAATTATTATCTTACAATTCTGG - Intergenic
1117568405 14:57020301-57020323 AAATGAAGAACATATAATTAAGG + Intergenic
1117703417 14:58438395-58438417 AGAGTATGAAAATATAATTCAGG - Intronic
1118625850 14:67658282-67658304 AAATTATTAAAACATAATTTAGG - Intronic
1119441720 14:74632809-74632831 AAAAAATCAAAATATTATTCAGG + Intergenic
1120496520 14:85244042-85244064 AAATTCTCAAGATAGAACTCAGG + Intergenic
1121881176 14:97501551-97501573 AAAGTTTCAACATATAAATTTGG - Intergenic
1124127386 15:26948485-26948507 AAACTATCAACGTATGATACTGG - Exonic
1124225731 15:27893206-27893228 AAATTATAAAAGTATTATTCAGG - Intronic
1125122562 15:36179638-36179660 AGATTATCAACTAAGAATTCAGG + Intergenic
1125202965 15:37117625-37117647 AAACTATTAACAAAAAATTCAGG - Intergenic
1125887143 15:43237521-43237543 AAATAAACAACAAATAATTTGGG + Intronic
1127005738 15:54567631-54567653 AAGTTATTAACGTCTAATTCAGG - Intronic
1127420488 15:58800433-58800455 AACTTATCAGCATATTATTTAGG + Intronic
1127800148 15:62470906-62470928 AACGTAGCAAAATATAATTCTGG + Intronic
1128354735 15:66917750-66917772 AAAACATCAACACATAAGTCAGG + Intergenic
1131120403 15:89819382-89819404 AAATTATAAACTTATATTTGTGG + Intergenic
1131346444 15:91653697-91653719 TAATTCTCAAGATAAAATTCTGG + Intergenic
1132736900 16:1390743-1390765 AAATTAAAAACATACAATTCAGG + Intronic
1134533398 16:15003680-15003702 AAATTATAAAAATATTTTTCTGG + Intronic
1134875677 16:17696544-17696566 AAATTAGCAAGATTTTATTCTGG - Intergenic
1135695237 16:24580413-24580435 CAATTATCAACATTTTATTTTGG - Intergenic
1138735318 16:59244095-59244117 AAATTATTAAAATTTAATTTAGG + Intergenic
1138925617 16:61587237-61587259 ATATTAAAAACATATAATGCTGG + Intergenic
1139500557 16:67360965-67360987 CATTTATTAACGTATAATTCTGG - Intronic
1139501025 16:67365810-67365832 ATAATAACAACATATAAGTCAGG - Intronic
1139715717 16:68811487-68811509 AAACTATCAACTTATTATCCAGG - Intronic
1139780455 16:69347164-69347186 CAACTATCAGCATCTAATTCTGG - Intronic
1139862634 16:70037063-70037085 AAATTATAAAAATATTTTTCTGG - Intergenic
1140018530 16:71213373-71213395 ACAATATCAACATTTAAGTCAGG + Intronic
1140134327 16:72192100-72192122 AAATAATAAACACAAAATTCAGG - Intergenic
1140174101 16:72638713-72638735 TATTTAACAACATAGAATTCAGG - Intergenic
1142505296 17:359425-359447 AAAATATCTACATATAGGTCTGG + Intronic
1144086425 17:11813085-11813107 AAATTATCAATACTTAATTGAGG - Intronic
1144324389 17:14164530-14164552 AAATCCTGAAAATATAATTCTGG - Intronic
1144389028 17:14776608-14776630 AAATTATCCCCATAAAATACTGG + Intergenic
1144491958 17:15720858-15720880 AAAATATCTCCATATCATTCAGG + Intergenic
1144562011 17:16328661-16328683 AAATTATCAATATTTGTTTCTGG + Intronic
1144871444 17:18374326-18374348 AAATTATCATTTTATCATTCTGG - Intergenic
1144908519 17:18658336-18658358 AAAATATCTCCATATCATTCAGG - Intronic
1146104281 17:30017263-30017285 AAAGTAACAAGATTTAATTCTGG - Intronic
1146565542 17:33909734-33909756 AAATGATCATTATATAATTTGGG + Intronic
1146701545 17:34964990-34965012 AAAATATAAACAAATAATCCAGG + Intronic
1149088429 17:52749588-52749610 AAAATAGAAACATATAATTTGGG - Intergenic
1149464492 17:56865986-56866008 AAATTATCAATATAAAATGCTGG - Exonic
1149669381 17:58392381-58392403 AACTTATCATCAAATAATGCTGG + Intronic
1149817586 17:59741254-59741276 AATTTATGAATATATAATCCTGG + Intronic
1150280387 17:63926758-63926780 AAATTATCACAATAAAATTGAGG - Intergenic
1150340235 17:64360695-64360717 AAAATATGAACATGTATTTCTGG - Intronic
1150608817 17:66716639-66716661 CAATTATCAACAGACAAATCTGG + Intronic
1150807744 17:68332582-68332604 AAATTATAAAAGTATAATTTTGG + Intronic
1154168886 18:12036548-12036570 TAATTATCCACCTATAAGTCTGG + Intergenic
1154209894 18:12370363-12370385 AAAATATCAACAGAAAATTAAGG + Intronic
1154478111 18:14787202-14787224 AAAATATCAAAAAATAATTTGGG - Intronic
1154513731 18:15137512-15137534 AAATTATCAACAGAGAAAACAGG + Intergenic
1155600869 18:27545604-27545626 AATTTATCAACATAAAAAGCAGG - Intergenic
1155799887 18:30088496-30088518 AAATTATAAAAATAAAACTCTGG + Intergenic
1156071354 18:33214521-33214543 AAATTATAAAGATCTAATTCAGG - Intronic
1156743495 18:40361335-40361357 AAATTATGAAGTTATAATTAAGG - Intergenic
1156978571 18:43257389-43257411 AAATTATCATGCTATAATACTGG + Intergenic
1157013931 18:43686663-43686685 AAAATAACGACATAAAATTCTGG + Intergenic
1157407976 18:47439776-47439798 CAATTATCAACCTGTAAGTCAGG - Intergenic
1158371029 18:56804367-56804389 AAATCCTGAAAATATAATTCTGG + Intronic
1158728493 18:59997029-59997051 AAATTATAAAACTGTAATTCTGG - Intergenic
1159186366 18:64980425-64980447 AAATTATGAACATATAAGCTAGG + Intergenic
1159386531 18:67732675-67732697 AAAATATCCAAATATAATTTAGG - Intergenic
1159596711 18:70389272-70389294 AAATTAACTACATATTACTCAGG - Intergenic
1159672914 18:71244722-71244744 AATTTATCTACATATAAATAAGG + Intergenic
1159740625 18:72165194-72165216 AAATCCCCAAAATATAATTCTGG - Intergenic
1160249556 18:77189723-77189745 CACTTTTCAACATATAATGCTGG - Intergenic
1160335702 18:78037044-78037066 AAATTATCAAGTTATATTTATGG + Intergenic
1162689455 19:12417099-12417121 AAATTATAAAAATATCATTTGGG - Intronic
1162853432 19:13449752-13449774 AAATAATAAACATAAAATTCAGG + Intronic
1163941697 19:20501105-20501127 AAATTATGAACATATTATTTGGG + Intergenic
925402233 2:3583251-3583273 AAATTCTAAACATATCATTTAGG + Intergenic
926816954 2:16807498-16807520 AAATTATCAAAAATTAATTCTGG - Intergenic
927262980 2:21113018-21113040 AAATTATTAATATATAATTTTGG - Intergenic
927526342 2:23744904-23744926 AAATTGTTAACATTTAATACTGG + Intergenic
927831908 2:26358613-26358635 AAACTCTCAGCATATAAATCTGG - Intronic
927891329 2:26751690-26751712 AACTTATTATCATACAATTCTGG - Intergenic
929065832 2:37974767-37974789 AAATTACCTAAATATAATCCTGG - Intronic
929351887 2:40966275-40966297 AAAATATCAACATATGAATTTGG + Intergenic
930190739 2:48456619-48456641 AAACTATTAACATATAATTATGG - Intronic
931655331 2:64505589-64505611 AAATGATAAACATAAAATTCAGG - Intergenic
934070129 2:88376316-88376338 AACTTATCAGCATAAAACTCAGG + Intergenic
935855443 2:107268108-107268130 AGAATTTCAACATATGATTCCGG + Intergenic
935933939 2:108161071-108161093 AAAATATGCACATATAATTATGG - Intergenic
936499761 2:113057067-113057089 TGATTATCAAAAGATAATTCAGG + Intergenic
936741134 2:115510181-115510203 ACTTTATCAACATTTAAATCTGG - Intronic
937315752 2:120931116-120931138 AACTTATCCTCATATCATTCCGG + Intronic
937606412 2:123806690-123806712 AAATTATAAAAATATTATTTGGG + Intergenic
937721740 2:125105577-125105599 AAATCAACAACATAAAAATCTGG - Intergenic
937966979 2:127520043-127520065 AAATTATTATCTTATAATTCTGG - Intronic
938044093 2:128100740-128100762 AAAGTAACAAAATGTAATTCAGG - Intronic
938256677 2:129864733-129864755 AAATTTAGAACAAATAATTCAGG + Intergenic
938507364 2:131900417-131900439 AAAGTATCACCATATTTTTCAGG - Intergenic
938513971 2:131982123-131982145 AAATTATCAACAGAGAAAACAGG + Intergenic
938636316 2:133230614-133230636 CATTTATTTACATATAATTCAGG + Intronic
939164355 2:138624200-138624222 CAATTATCAATATATAATAGTGG - Intergenic
939176342 2:138752329-138752351 AAATTAACAACGGAGAATTCAGG + Intronic
939758771 2:146148107-146148129 AAATTTTCAAGTTTTAATTCAGG - Intergenic
940213432 2:151279775-151279797 AATTTAACATCATCTAATTCTGG - Intronic
940455670 2:153895840-153895862 AAATTATCATCAAATATTTGTGG - Intronic
940777418 2:157899412-157899434 AAATTATCAACGTAGAACCCAGG + Intronic
941678187 2:168366640-168366662 AGATTATCAAAATAAAATTCAGG + Intergenic
941702791 2:168622425-168622447 AAAATATAAACATTAAATTCAGG - Intronic
941835339 2:170011208-170011230 AAATTAACAACATATATTGAAGG + Intronic
942223634 2:173795565-173795587 AAATAATCAAGATTTAAATCAGG + Intergenic
942262002 2:174175022-174175044 AGATATTCAACAAATAATTCTGG + Intronic
942305571 2:174603885-174603907 AAATCCTGAAAATATAATTCTGG + Intronic
942388686 2:175468813-175468835 AAATGGTCAACTTATTATTCAGG - Intergenic
942466830 2:176217357-176217379 AATTTATTACCTTATAATTCTGG + Intergenic
942501800 2:176598958-176598980 AAAGTATCAAAATTTGATTCTGG + Intergenic
942659459 2:178248854-178248876 AAATTAACAATAGTTAATTCTGG - Intronic
943127933 2:183819294-183819316 AAATTGTCAGCAAATAGTTCAGG - Intergenic
943341394 2:186686174-186686196 AAAATAGCAACCTACAATTCTGG + Intergenic
943397759 2:187362322-187362344 TAATTAGCAACATAAAAATCTGG - Intronic
943696010 2:190931768-190931790 AAATTGTTGACATATAAATCCGG + Intronic
944324276 2:198385302-198385324 AATTTATTAACATATACTTAAGG - Intronic
944354406 2:198768786-198768808 AAATTATGTAAATATAACTCTGG - Intergenic
945121663 2:206463477-206463499 AAATTATCATCTTACACTTCTGG - Intronic
945387734 2:209223457-209223479 ATATTTTAAACTTATAATTCAGG + Intergenic
945534651 2:211000175-211000197 TAATTTTCAACAAATAATTCAGG - Intergenic
945578403 2:211561073-211561095 AAATTATCAAGATAGATATCTGG + Intronic
1168767680 20:392871-392893 AAATTTTTAAAAGATAATTCTGG + Intronic
1169449395 20:5698563-5698585 AAATCAGCAAAATAAAATTCTGG - Intergenic
1169668714 20:8070347-8070369 AAATTATGAATATAGGATTCAGG + Intergenic
1170123558 20:12936796-12936818 GACTAATGAACATATAATTCAGG - Intergenic
1170339314 20:15305362-15305384 TAATTATAACCAGATAATTCTGG - Intronic
1170565830 20:17604062-17604084 AAAATATTAGCATTTAATTCTGG + Intronic
1171750279 20:29042622-29042644 AAATTCTGAACATACAATTCTGG - Intergenic
1173110526 20:40183565-40183587 ACATTACCAACATATTATTTAGG - Intergenic
1174946754 20:54994616-54994638 AAATCCTAAAAATATAATTCTGG - Intergenic
1175261742 20:57678933-57678955 AAAGTATCAACATATTGTTCAGG + Intronic
1175631331 20:60539530-60539552 GAATGATCAACATAAAATTTAGG + Intergenic
1175637132 20:60594717-60594739 AAATCCTCAAAATACAATTCTGG - Intergenic
1176314933 21:5233294-5233316 AAATTCTGAACATACAATTCTGG + Intergenic
1176779812 21:13180772-13180794 AAATTATCAACAGAGAAAACAGG - Intergenic
1177191355 21:17855356-17855378 AAATTCTAAAAATATAATTCTGG - Intergenic
1177191499 21:17856872-17856894 ATATTATTAACATATGACTCAGG + Intergenic
1177318056 21:19486670-19486692 AAGTTCTCCACATATAATTCAGG + Intergenic
1177676105 21:24301202-24301224 ACATGCTTAACATATAATTCAGG - Intergenic
1177679798 21:24351882-24351904 AAATTATTAAAAAAGAATTCTGG + Intergenic
1177802131 21:25838479-25838501 AAATTATTATCTTATAGTTCTGG + Intergenic
1177977460 21:27869798-27869820 AAATTATCAACAGAGAAAACAGG - Intergenic
1178178119 21:30128452-30128474 AAAGTATGTACATAAAATTCAGG - Intergenic
1179498618 21:41791574-41791596 AAATCCTGAAAATATAATTCTGG + Intergenic
1180026516 21:45165944-45165966 AAATTACTAACATATATTACTGG - Intronic
1181132441 22:20740832-20740854 AAACTATCAACCTAGAATCCTGG + Intronic
1183805432 22:40206122-40206144 AAATTAAAAAAATATATTTCTGG - Intronic
949495864 3:4631533-4631555 AAATCCCCAAAATATAATTCCGG - Intronic
949715870 3:6930714-6930736 AAATGATCAACCTATCAGTCTGG - Intronic
951223937 3:20098682-20098704 AAATTAAATACAAATAATTCTGG - Intronic
952477217 3:33722810-33722832 AAATAATGAACAAATAAGTCAGG - Intergenic
952903303 3:38123518-38123540 AAATCCTGAAAATATAATTCTGG + Exonic
953086574 3:39674176-39674198 AAATTATCATCTTACAGTTCTGG + Intergenic
953515090 3:43582656-43582678 AACTTATGAAAATATAATTGTGG - Intronic
955546066 3:60031709-60031731 AAATTATCAACAGGTAATTTGGG + Intronic
956638561 3:71391762-71391784 AAATTTTCTTAATATAATTCAGG - Intronic
957017666 3:75087654-75087676 AAATCCTGAAAATATAATTCTGG - Intergenic
957065768 3:75520654-75520676 CAACTATTAAAATATAATTCAGG + Intergenic
957864183 3:86000898-86000920 AAAATAGAAACATAGAATTCTGG + Intronic
958088028 3:88837847-88837869 AAATTACCAACAAAAAGTTCAGG - Intergenic
958725557 3:97901569-97901591 AAAATTTCAACATAAAAATCTGG - Intronic
958856112 3:99387793-99387815 AGGTTATCAACATATGAATCGGG - Intergenic
959450637 3:106495158-106495180 AAATTCTACACATGTAATTCTGG + Intergenic
959484837 3:106914806-106914828 AAAATAGCAACAAAAAATTCAGG - Intergenic
959777877 3:110190240-110190262 ATAATATGAACATATAATTTTGG + Intergenic
960415640 3:117382116-117382138 AAACTTTAAACATATTATTCAGG - Intergenic
960645383 3:119875135-119875157 AAAGTTACAACCTATAATTCTGG + Intronic
961287382 3:125817406-125817428 TAACTATTAAAATATAATTCGGG - Intergenic
961899703 3:130198563-130198585 TAACTATTAAAATATAATTCAGG + Intergenic
963500137 3:146115266-146115288 AAATTTTCCACATATAACTGTGG + Intronic
963876038 3:150475628-150475650 ATCTTTTCAACAAATAATTCTGG - Intergenic
964649951 3:158999558-158999580 AAATTTTAAACATAAAACTCTGG - Intronic
964784408 3:160379065-160379087 AACTTATTAACTTATAATTAAGG + Intronic
964811983 3:160675208-160675230 AAATTATCAAGAAATAATATGGG - Intergenic
964837482 3:160955353-160955375 AAATAATCAGGAAATAATTCTGG - Intronic
964858611 3:161174619-161174641 AAATTATAAGGATATAATGCTGG - Intronic
965071498 3:163920996-163921018 AGATTATCAACATAAAATGTTGG - Intergenic
965172367 3:165282538-165282560 AAATCCTGAATATATAATTCAGG + Intergenic
965612803 3:170562644-170562666 AAATTAAAAAAATATAAATCAGG + Intronic
965895496 3:173570680-173570702 AATTTGTAAACAAATAATTCAGG - Intronic
965911668 3:173785323-173785345 AAATTATCAAGATATATTGATGG - Intronic
965997531 3:174903002-174903024 CAACTGTCAACATATAATTTTGG - Intronic
966036848 3:175428094-175428116 AAATGATCAATATCTAAATCTGG - Intronic
966498369 3:180607286-180607308 AAATTATCTACAGAAAATTTTGG - Intronic
966980034 3:185123868-185123890 AAATCCTGAAAATATAATTCTGG - Intronic
969010365 4:4056717-4056739 TAACTATTAAAATATAATTCAGG + Intergenic
969283588 4:6188617-6188639 AAATTAGCAACTTATTAATCTGG + Intronic
969978445 4:11128597-11128619 AAATCTTGAAAATATAATTCTGG + Intergenic
970755116 4:19416483-19416505 AAATTATTAACACATGATTAGGG + Intergenic
971415023 4:26417531-26417553 TAAATATTAACATATAATTTTGG - Intronic
971602412 4:28610781-28610803 AAATTATCCACATATAGAACAGG + Intergenic
971615593 4:28786930-28786952 AAAAAATAAACATATAATTCAGG - Intergenic
971789128 4:31144629-31144651 GAATTATCAACCTATATTCCAGG - Intronic
971881591 4:32381927-32381949 AACTTATTAACATATAAGGCTGG - Intergenic
972350123 4:38229019-38229041 AACTTATCAACATGTACTTGGGG + Intergenic
972552008 4:40142407-40142429 AAATTATCAAAATACAATTAGGG - Intronic
972664510 4:41151189-41151211 AAATTGTTAACATATAATGGTGG + Intronic
972701597 4:41499470-41499492 ATACTAGCAACATTTAATTCTGG - Intronic
973093614 4:46169150-46169172 AAATTATTCACATATATTTGTGG - Intergenic
973176306 4:47210378-47210400 AAATTATCCACATTAAATTTAGG + Intronic
973584346 4:52375793-52375815 AAATTATCAACATGCACTGCTGG - Intergenic
973874215 4:55199242-55199264 AAATTCTAAAAATATAATTCTGG + Intergenic
974289203 4:59909544-59909566 AAATAATATATATATAATTCTGG + Intergenic
974310450 4:60201467-60201489 AAATCATCAACATATATATGTGG - Intergenic
975137564 4:70889578-70889600 AATTTATTATCCTATAATTCTGG - Intergenic
975327248 4:73072451-73072473 AAATTTTCAGCACTTAATTCAGG - Intergenic
975329908 4:73100786-73100808 AAATTTTCAAAATAAAATGCTGG + Intronic
976170262 4:82296560-82296582 TACTTATAAATATATAATTCAGG + Intergenic
976480498 4:85538325-85538347 AAATAATCAACATATAACTACGG - Intronic
977036202 4:91956787-91956809 GAATTCTCAACATCTTATTCTGG - Intergenic
977251704 4:94695746-94695768 AAATTATCATCAAATAACTTGGG + Intergenic
977396024 4:96471333-96471355 TAATTTTGAAAATATAATTCTGG + Intergenic
977634216 4:99277696-99277718 AAATTCTCATGATATAATTTAGG - Intronic
977765187 4:100788962-100788984 AAATTATGAACAACTAATTACGG + Intronic
978908852 4:114042313-114042335 CAATCATTAACATATACTTCTGG + Intergenic
979043374 4:115830211-115830233 GAGTCATCAAAATATAATTCTGG + Intergenic
979070384 4:116196533-116196555 GAAGTATCAACATAAATTTCTGG + Intergenic
979093173 4:116513762-116513784 AAATCATTAGCATAAAATTCAGG - Intergenic
979124981 4:116958131-116958153 AAAAGAACCACATATAATTCTGG - Intergenic
979658950 4:123230291-123230313 GAAATGTCAACAAATAATTCAGG - Intronic
979824000 4:125210545-125210567 AAATTATTAGCTTACAATTCTGG + Intergenic
980254597 4:130362490-130362512 AATATATCAACACATAAATCTGG - Intergenic
980807514 4:137832742-137832764 AAATTATCAACATGAATGTCAGG - Intergenic
981316759 4:143348233-143348255 AAATTATCAACATATAATTCAGG - Intronic
981959679 4:150522068-150522090 AAATTATTATCCTATAATTCTGG + Intronic
981983282 4:150823372-150823394 ATATAATAAACTTATAATTCTGG - Intronic
982648685 4:158057842-158057864 AAAATATCTACTCATAATTCTGG - Intergenic
982903982 4:161044854-161044876 AAATTATCAATAACTATTTCTGG + Intergenic
982922296 4:161290993-161291015 AAATTATAAAAATATTATTAGGG - Intergenic
983303468 4:165956771-165956793 AAATTATAAAAGTATAATTTGGG + Intronic
983329781 4:166310581-166310603 AGATTATCAATATATGTTTCTGG - Intergenic
983475833 4:168210791-168210813 ATATCATCAACATATGAATCTGG - Intergenic
984202668 4:176745328-176745350 AAATGATGAACAAATAATTCAGG - Intronic
984379263 4:178969559-178969581 CATTTATCAGCATTTAATTCTGG - Intergenic
984467103 4:180113716-180113738 AAGCTATCATCATTTAATTCAGG - Intergenic
985029321 4:185773013-185773035 AAAGTTTCAACGTAAAATTCAGG + Intronic
985052108 4:186001226-186001248 AAAATATGAACATATAGTTAAGG - Intergenic
985104684 4:186488952-186488974 AAATTATCCACAAAGAATTTAGG + Intronic
985130849 4:186737356-186737378 AAATCATGAACCTATATTTCAGG + Intergenic
985432193 4:189892255-189892277 AAATTCTGAAAATACAATTCTGG - Intergenic
987005045 5:13702355-13702377 AAATTATGATCATTTTATTCAGG - Intronic
987494478 5:18626112-18626134 AACTTCTCAACCTATAATTTGGG + Intergenic
987499395 5:18687929-18687951 TAATTATACACATATATTTCAGG + Intergenic
987567678 5:19614296-19614318 ATATTGTGAACATATAATTGAGG + Intronic
987660574 5:20868252-20868274 AAATTATTAGCATATACTTTTGG - Intergenic
987698269 5:21360358-21360380 AAATTATCTGAATATATTTCAGG - Intergenic
987902490 5:24030968-24030990 AAATTATAAAAATATTATTTGGG - Intronic
988075097 5:26342176-26342198 AATTTATTCTCATATAATTCTGG - Intergenic
988332117 5:29855431-29855453 AATTTATCAACCTACAATTCTGG - Intergenic
988445525 5:31282182-31282204 AATTTATCATCTCATAATTCTGG + Intronic
988754385 5:34231174-34231196 AAATTATCTGAATATATTTCAGG + Intergenic
988763072 5:34337428-34337450 AAATTATTAGCATATACTTTTGG + Intergenic
988779515 5:34507233-34507255 AAACTATGAACATATATATCTGG - Intergenic
989096054 5:37782227-37782249 AAATTAGCACCATTTAATCCAGG - Intergenic
989238826 5:39180198-39180220 AAATTATAGAAATATTATTCTGG - Intronic
989295982 5:39827157-39827179 AAATTTTCCAAATTTAATTCAGG + Intergenic
990284912 5:54291762-54291784 AAGTTTTCAACATGTAAATCTGG + Intronic
991256264 5:64618435-64618457 AATTTATCAACAGACCATTCTGG + Intergenic
991648903 5:68831318-68831340 AAATGATAAACACAAAATTCAGG + Intergenic
991664788 5:68988226-68988248 AAATGATCAAAATAAAATTATGG + Intergenic
991742162 5:69692016-69692038 AAATTATCTGAATATATTTCAGG + Intergenic
991755531 5:69863192-69863214 AAATTATCTGAATATATTTCAGG - Intergenic
991793736 5:70271756-70271778 AAATTATCTGAATATATTTCAGG + Intergenic
991821553 5:70567320-70567342 AAATTATCTGAATATATTTCAGG + Intergenic
991834858 5:70738340-70738362 AAATTATCTGAATATATTTCAGG - Intergenic
991886114 5:71271288-71271310 AAATTATCTGAATATATTTCAGG + Intergenic
992074172 5:73175727-73175749 AATTTATGAACATAAAATTATGG - Intergenic
992637575 5:78739652-78739674 AAATTATACATATATATTTCTGG + Intronic
992794178 5:80240831-80240853 AAAATATCAAAAAATTATTCAGG - Intronic
993063576 5:83071649-83071671 AAATTATCAACATTTTCTTTTGG + Intronic
993264237 5:85702163-85702185 TAATTATAAACATATAATCAAGG - Intergenic
993273408 5:85824409-85824431 AAAATATTTACATAAAATTCAGG - Intergenic
993293617 5:86107147-86107169 AAACTAATAAAATATAATTCTGG - Intergenic
993498400 5:88634443-88634465 AAATTGCCAACCTATAGTTCAGG - Intergenic
993961435 5:94301662-94301684 AAAATATCACCATAAATTTCAGG + Intronic
994009777 5:94888025-94888047 AAAATATCAACTTATCATTCTGG - Intronic
994055658 5:95411306-95411328 AAATCCCCAAAATATAATTCTGG + Intronic
994202355 5:96992101-96992123 AAACTATAAACATTTTATTCAGG - Intronic
994565240 5:101437443-101437465 GAATTATCAGCTTATGATTCAGG - Intergenic
994842459 5:104943022-104943044 CAATTATCCACACATAATGCTGG + Intergenic
995102603 5:108332097-108332119 GAATGATAAACATAAAATTCAGG + Intronic
995415175 5:111903002-111903024 AACTTCTCAACATAAAAGTCAGG - Intronic
995647962 5:114334528-114334550 AAATTATGAACATGTAATAAAGG - Intergenic
995907061 5:117137362-117137384 TAAATATCTACAAATAATTCTGG + Intergenic
995931009 5:117444149-117444171 AAAATAACAACATATATTTTGGG - Intergenic
996146008 5:119977201-119977223 AAATGATCAAAGGATAATTCCGG - Intergenic
996331018 5:122329006-122329028 AATTTATCACCATACAATTGTGG - Intronic
997827318 5:137118128-137118150 ATAATATCAACATGTGATTCTGG - Intronic
998198237 5:140095440-140095462 AAATAATAAACATAAAATTTAGG + Intergenic
998593533 5:143503109-143503131 AAATTCTAAAAACATAATTCTGG - Intergenic
999885654 5:155920132-155920154 AAATGATCAACATCTAACCCTGG + Intronic
1000550302 5:162653641-162653663 AAAATATCCACATATAATTGGGG + Intergenic
1000719366 5:164687794-164687816 AAATCATCACTTTATAATTCAGG + Intergenic
1001272367 5:170323940-170323962 AAATCCTGAAAATATAATTCTGG - Intergenic
1002949132 6:1791205-1791227 AAATTATCATCTTACAGTTCTGG - Intronic
1004037502 6:11937765-11937787 AAATTATAAAGTTATAATTTTGG + Intergenic
1004700764 6:18077416-18077438 AAATTCTGAAAATATAATTCTGG - Intergenic
1005039717 6:21589755-21589777 AAAATATCAAAATAGGATTCTGG - Intergenic
1005131305 6:22511564-22511586 AAATTATCATCATTTAATTCAGG + Intergenic
1005552570 6:26938028-26938050 AAATTATCTGAATATATTTCAGG + Intergenic
1007133428 6:39498289-39498311 AAATTATCAACAGCTGATTAGGG - Intronic
1007797678 6:44363561-44363583 GAATCATAAACATAAAATTCAGG - Intronic
1008832255 6:55780104-55780126 TAATTATCAATATATAATACTGG - Intronic
1009339145 6:62531865-62531887 AAATTAAAAATATTTAATTCAGG - Intergenic
1010522350 6:76853505-76853527 AGAATATTAACATAAAATTCTGG + Intergenic
1010812916 6:80320754-80320776 AAATTATCAACATTTGGTTATGG + Intronic
1012051286 6:94347696-94347718 AAATTTTTAACATATATTTGGGG - Intergenic
1012177575 6:96107559-96107581 ATATTTTCAACATGTATTTCGGG - Intronic
1012476178 6:99616742-99616764 AAACTATCAACATGTAAATATGG + Intergenic
1012716370 6:102677696-102677718 AAATTATCAGCATTGAGTTCAGG - Intergenic
1013580256 6:111527047-111527069 AAATTATTTTCTTATAATTCTGG + Intergenic
1014119802 6:117711841-117711863 AAAATATGCACATATAATTTAGG - Intergenic
1014373040 6:120637476-120637498 AAAATATATATATATAATTCAGG - Intergenic
1014373675 6:120643650-120643672 AAATTTACAAAATATAATTCAGG - Intergenic
1014519862 6:122428690-122428712 AAAGAATCAAAATAAAATTCTGG - Intronic
1014687312 6:124518007-124518029 AATTTATCAACATTTATTTTAGG + Intronic
1014804360 6:125812590-125812612 AAATTATCAGCATATGCTTGTGG - Intronic
1015000845 6:128213252-128213274 ATATTATCTACTTGTAATTCAGG - Intronic
1015768210 6:136741447-136741469 AAATTATCAACATCTTATTCAGG - Intronic
1016571265 6:145515692-145515714 AGAATTTCAACATATAAATCTGG + Intronic
1018939435 6:168299135-168299157 TAATTTTCCACATATAATTTAGG - Intronic
1020915736 7:14190222-14190244 AAATTAACAAAATAAAATTTTGG + Intronic
1022422263 7:30234761-30234783 AAAATAATCACATATAATTCAGG - Intergenic
1023325185 7:39047010-39047032 AAATTGTAAACATTTAATTCTGG + Intronic
1024032870 7:45479488-45479510 AAATTATTAACACATACTCCCGG - Intergenic
1024640538 7:51325156-51325178 AAAAGATCAAATTATAATTCTGG - Intergenic
1025088055 7:56039282-56039304 TAATTTACAACATAAAATTCAGG + Intronic
1026582464 7:71629777-71629799 AAAGTTTAAAAATATAATTCAGG - Intronic
1027711426 7:81606520-81606542 ATATTATTATCATATATTTCAGG + Intergenic
1027793855 7:82667325-82667347 TAATTATAAAGATATAATTAAGG - Intergenic
1027793899 7:82668148-82668170 AGATTTTCAACATATGAATCTGG + Intergenic
1027823101 7:83074022-83074044 AAATTAAACACATATAATTGTGG + Intronic
1027896876 7:84055728-84055750 TAAGAATCAACATATAATTTGGG - Intronic
1028253474 7:88563331-88563353 CAATTAGCAGCAAATAATTCTGG + Intergenic
1028290680 7:89061287-89061309 AAATTTCAAAAATATAATTCTGG - Intronic
1028364183 7:90007648-90007670 AAATAATTAAAATATAATTTGGG - Intergenic
1028378663 7:90174748-90174770 AAATTATCACCAAATACTTGGGG + Intronic
1028860429 7:95642920-95642942 AAATTATAAACACAAAATGCTGG - Intergenic
1029069652 7:97884718-97884740 TAACTATTAAAATATAATTCAGG + Intergenic
1029878348 7:103778540-103778562 AAATTATCAAAATAAGATTCAGG + Intronic
1030119984 7:106100364-106100386 AAATTAACAACATAGAATGTTGG + Intronic
1030570713 7:111219406-111219428 AAATTTTAAACAAATAATGCAGG + Intronic
1030813931 7:114010866-114010888 AAATTAAGAACACAAAATTCAGG + Intronic
1030982990 7:116208758-116208780 AAATTATAAAAATAAAATTGAGG - Intergenic
1031073042 7:117183434-117183456 AAATTATATATATATAATTGAGG + Intronic
1031213532 7:118860893-118860915 AAGATTTCAACATATAAGTCTGG + Intergenic
1031213954 7:118866851-118866873 CAATTATAAAAATATAATTATGG - Intergenic
1031335606 7:120527314-120527336 AAGTTATAAACATATAACCCTGG - Intronic
1031358518 7:120818321-120818343 ACATTATAAAAACATAATTCTGG + Intronic
1031479579 7:122261960-122261982 AAATTATCTACATAAAGTACAGG + Intergenic
1031700463 7:124918698-124918720 GAATTGTAAACATGTAATTCTGG - Intronic
1031901503 7:127416069-127416091 AAATTCTCTAGATAGAATTCAGG + Intronic
1032918267 7:136516006-136516028 AAATGTTAAACATAAAATTCGGG + Intergenic
1033472076 7:141659352-141659374 AAATTCTAAACACATAATTTGGG + Exonic
1033478827 7:141718129-141718151 TCATTTTCAACATCTAATTCTGG - Intronic
1033920247 7:146382065-146382087 AAAATATCAAGATATTTTTCTGG + Intronic
1033962866 7:146935333-146935355 AGGTTATCTACATATAAGTCTGG - Intronic
1034299490 7:150002709-150002731 AAATTATCTATATAAAATACAGG - Intergenic
1034806512 7:154094064-154094086 AAATTATCTATATAAAATACAGG + Intronic
1036251893 8:7169386-7169408 TAACTATTAAAATATAATTCAGG + Intergenic
1036365598 8:8118075-8118097 TAACTATTAAAATATAATTCAGG - Intergenic
1036450396 8:8861565-8861587 AAATTAACAAGATATAATAAAGG + Intronic
1036885351 8:12548031-12548053 TAACTATTAAAATATAATTCAGG + Intergenic
1037092297 8:14936121-14936143 AGATTTTCTACATGTAATTCAGG + Intronic
1037193807 8:16161640-16161662 AAATGATAAACACAAAATTCAGG - Intronic
1037217953 8:16480805-16480827 AAATTATCAACATGTCTTTTGGG - Intronic
1038803959 8:30773927-30773949 AAATTAGAAACATATGATTAAGG + Intergenic
1039176563 8:34814338-34814360 TAATTCTCAAAATATAATTTAGG + Intergenic
1039403057 8:37288445-37288467 AAATTAACAACATAAAATATGGG - Intergenic
1040742199 8:50590798-50590820 AAATAATCTGCATAAAATTCTGG + Intronic
1041056806 8:53994438-53994460 AAAATATAAACAAATATTTCTGG + Intronic
1041126331 8:54644034-54644056 ATATTATCAAAATAAAATTTGGG + Intergenic
1041506136 8:58599842-58599864 ACATCATCACCATAGAATTCTGG + Exonic
1041788144 8:61658834-61658856 AAATTATCTAAAAATATTTCAGG - Intronic
1042240698 8:66661411-66661433 AAATTAATCAAATATAATTCTGG - Intronic
1042300270 8:67272141-67272163 AAATTATAAATATATGGTTCAGG - Intronic
1042359496 8:67866701-67866723 AAATTAAAAACATATTACTCTGG - Intergenic
1042418483 8:68556445-68556467 AAATTATCAAGATACTAATCAGG - Intronic
1042506748 8:69568775-69568797 AAGTGATCAACATAAAGTTCAGG + Intronic
1043113867 8:76223098-76223120 AAATAACCAAAATATAATTTTGG + Intergenic
1043497645 8:80820488-80820510 AGATTATCAAGATATAAACCAGG + Intronic
1043658226 8:82700276-82700298 AAAATAAAATCATATAATTCAGG - Intergenic
1043960729 8:86415287-86415309 AAATTTTCAACATAAAATGTTGG - Intronic
1044065970 8:87700620-87700642 AAATTATAAATATATAATTCTGG - Intergenic
1044490014 8:92802524-92802546 AAAAGATCAACACATAATACAGG + Intergenic
1044580682 8:93823137-93823159 AAAGTATCATCTTACAATTCTGG + Intergenic
1044746616 8:95377119-95377141 ATAAAATCAACATATAATGCTGG - Intergenic
1044859216 8:96506268-96506290 GAAATATCAACAGATCATTCAGG - Intronic
1045429598 8:102101251-102101273 ATAATATCCACATATAATACTGG - Intronic
1045514863 8:102850055-102850077 AAATAATCACAAGATAATTCTGG + Intronic
1046292135 8:112176783-112176805 AGATTATAAACATATATTTTAGG + Intergenic
1046316804 8:112513587-112513609 GAATTACCAAAATATAATACAGG + Intronic
1046333286 8:112750319-112750341 AAATTATTAAATTATAATTATGG - Intronic
1046704085 8:117431486-117431508 AAATAATAAACATATTATTTAGG + Intergenic
1047169250 8:122475009-122475031 AAAGTCTCAACAAATATTTCTGG + Intergenic
1047385922 8:124409019-124409041 AAATAGCCAACATATAATCCTGG - Intergenic
1047679905 8:127244077-127244099 AAATAATAAACAAAGAATTCAGG + Intergenic
1047846386 8:128810180-128810202 TAAATAACAACATATAATTTTGG - Intergenic
1048061505 8:130924009-130924031 AAAGGATCAACATATAGTTTAGG - Intronic
1048599434 8:135903922-135903944 AAATGATAACCATTTAATTCTGG + Intergenic
1049155627 8:141065080-141065102 AAATCCTGAAAATATAATTCTGG - Intergenic
1050077091 9:1876497-1876519 AAACTATGAATATATAATTCTGG + Intergenic
1050748527 9:8907246-8907268 AATTTGTCAACATAAAATTAGGG + Intronic
1050777300 9:9281586-9281608 ATATTAACAACACAAAATTCTGG + Intronic
1051565316 9:18490497-18490519 AAAGTATCAACAAAGCATTCAGG + Intronic
1051746125 9:20297018-20297040 AAATCCCCAAAATATAATTCTGG - Intergenic
1051880571 9:21835673-21835695 AAATTATACACATTTCATTCTGG + Intronic
1052202467 9:25799480-25799502 AGAGCATCAACATATAAATCCGG + Intergenic
1052666714 9:31504366-31504388 AAATTATGAATATTTAATTGTGG + Intergenic
1053408149 9:37895782-37895804 AAATTATTAACAAGTAATCCAGG + Intronic
1053721362 9:40950313-40950335 AAATTCTCAAAATACAATTCTGG - Intergenic
1054344636 9:63901855-63901877 AAATTCTCAAAATACAATTCTGG + Intergenic
1054853597 9:69874229-69874251 AAATTAACTACTTAGAATTCTGG - Intronic
1055268445 9:74526999-74527021 AATCTATCAACATATAATATTGG - Intronic
1056177664 9:84051157-84051179 AAATATTAAACATAAAATTCAGG - Intergenic
1056270045 9:84938540-84938562 AAATTATATATATATATTTCTGG + Intronic
1056289786 9:85131433-85131455 AAATAATCAATATATAAATTTGG - Intergenic
1057289508 9:93794223-93794245 AAATCTTAAAAATATAATTCTGG + Intergenic
1057323677 9:94039297-94039319 AAATTATATACAAATAACTCAGG + Intronic
1057845982 9:98524030-98524052 AATTTATTAGCATATATTTCAGG - Intronic
1059523217 9:114963445-114963467 AAATTATAAAAGTATTATTCAGG + Intergenic
1059648817 9:116295247-116295269 CACTTTTCAATATATAATTCTGG - Intronic
1060251058 9:121987137-121987159 AAATAATCAACATAAAATTCAGG + Intronic
1061348836 9:130047837-130047859 AACTAATAAACATCTAATTCGGG + Intergenic
1203453827 Un_GL000219v1:145834-145856 AAATTCTGAAAATACAATTCTGG + Intergenic
1185513836 X:683545-683567 ATATTTCCAAAATATAATTCTGG - Intergenic
1186224831 X:7387605-7387627 TAATTATAAACATATAAAACTGG - Intergenic
1187015167 X:15319453-15319475 AAATTATCAAAATGTCATTCTGG + Exonic
1187781556 X:22832335-22832357 ACAATATCAGCATATACTTCTGG - Intergenic
1188050585 X:25480333-25480355 AAATTATCCAAATATCATTTTGG + Intergenic
1188120532 X:26300774-26300796 AAATCATGAAAATATAATTCTGG + Intergenic
1188362907 X:29278619-29278641 AAATTATCATCAGGTAATTGTGG - Intronic
1188541597 X:31256718-31256740 AAATTATCTACATATATGTGGGG + Intronic
1188801994 X:34543807-34543829 TAAGTTTCAACATATGATTCAGG + Intergenic
1189554153 X:42124991-42125013 AAATTATCAAGTTAGAATTGAGG + Intergenic
1189857978 X:45242639-45242661 AAATTATTAACAAAAATTTCTGG + Intergenic
1190035057 X:47015148-47015170 AAATTATGAATATATTATTTTGG + Intronic
1190379288 X:49823159-49823181 ATATTAACAACATATAATTGGGG - Intergenic
1190576398 X:51843628-51843650 AATTTATCATCTTATAATTCTGG - Intronic
1191078165 X:56478824-56478846 AAAATAACAATATATAATTTTGG - Intergenic
1191127289 X:56971239-56971261 AAATTCTCAATATAAAATACTGG + Intergenic
1191638035 X:63399360-63399382 AAATTTTCAAATTATCATTCTGG - Intergenic
1192126650 X:68507017-68507039 AAATTATAAAAATATAATTTAGG - Intronic
1192403483 X:70860623-70860645 AAATACTGAACTTATAATTCTGG - Intronic
1192709605 X:73566121-73566143 AAACTATGATGATATAATTCTGG - Intronic
1193256980 X:79360534-79360556 AAATTGTTCACATATAAGTCAGG + Exonic
1193313634 X:80038704-80038726 AAGTTATCCACATATAAGACTGG + Intergenic
1193577873 X:83226081-83226103 AAATTATCAACAGAGAAAACAGG - Intergenic
1193663171 X:84281684-84281706 AAATAATCAATATATAATTAAGG - Intergenic
1193682082 X:84533973-84533995 AAAGTACCAGCACATAATTCAGG + Intergenic
1193861670 X:86675107-86675129 AAATTCTAAACACAAAATTCTGG - Intronic
1193958746 X:87897064-87897086 AGATTATGCACATATAAGTCTGG + Intergenic
1194160606 X:90446246-90446268 AAAATATGTACATATAACTCTGG - Intergenic
1194205653 X:91008432-91008454 ACATGATCAACATATAAATTTGG - Intergenic
1194586610 X:95742519-95742541 AAATTAACAACATAGAAAACTGG + Intergenic
1194935729 X:99945793-99945815 AAAATATCAACAAAAAATTGTGG + Intergenic
1195534285 X:105993417-105993439 AAATTATAATCATATAGTTATGG + Intergenic
1195646528 X:107237008-107237030 AAATTTTCAAAATATAAATTAGG + Intronic
1196850139 X:119929934-119929956 CAATTACCAAAATATAATTCTGG + Intronic
1197454979 X:126667983-126668005 AAATTATTAAAAAATAATTTAGG + Intergenic
1197566673 X:128096304-128096326 GAGTTTTCAACAAATAATTCTGG - Intergenic
1197628576 X:128831828-128831850 AAATTATGAAAATATTATTTGGG - Intergenic
1199283642 X:146032112-146032134 ACACTGTCAACAAATAATTCTGG + Intergenic
1199528838 X:148824523-148824545 AAATTATTAATATATATTTATGG - Intronic
1199927883 X:152488249-152488271 AAATTAGCAAAACAAAATTCTGG + Intergenic
1200506897 Y:4023176-4023198 AAAATATGTACATATAACTCTGG - Intergenic
1200551412 Y:4583243-4583265 ACATGATCAACATATAAATTTGG - Intergenic
1201308897 Y:12576761-12576783 AAATTAGCACCATTTAATCCAGG + Intergenic