ID: 981316762

View in Genome Browser
Species Human (GRCh38)
Location 4:143348274-143348296
Sequence CATTTCTCATTCCAGATCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981316759_981316762 18 Left 981316759 4:143348233-143348255 CCTGAATTATATGTTGATAATTT 0: 1
1: 0
2: 5
3: 61
4: 570
Right 981316762 4:143348274-143348296 CATTTCTCATTCCAGATCTATGG No data
981316758_981316762 19 Left 981316758 4:143348232-143348254 CCCTGAATTATATGTTGATAATT 0: 1
1: 0
2: 3
3: 46
4: 442
Right 981316762 4:143348274-143348296 CATTTCTCATTCCAGATCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981316762 Original CRISPR CATTTCTCATTCCAGATCTA TGG Intronic
No off target data available for this crispr