ID: 981320838

View in Genome Browser
Species Human (GRCh38)
Location 4:143389312-143389334
Sequence CTCACTAGGTTTTAATTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981320838_981320843 -5 Left 981320838 4:143389312-143389334 CCTTTTAATTAAAACCTAGTGAG 0: 1
1: 0
2: 2
3: 17
4: 223
Right 981320843 4:143389330-143389352 GTGAGATTGGTGGCAATGTTGGG 0: 1
1: 0
2: 0
3: 5
4: 149
981320838_981320844 5 Left 981320838 4:143389312-143389334 CCTTTTAATTAAAACCTAGTGAG 0: 1
1: 0
2: 2
3: 17
4: 223
Right 981320844 4:143389340-143389362 TGGCAATGTTGGGAAGCAGATGG 0: 1
1: 0
2: 2
3: 42
4: 408
981320838_981320842 -6 Left 981320838 4:143389312-143389334 CCTTTTAATTAAAACCTAGTGAG 0: 1
1: 0
2: 2
3: 17
4: 223
Right 981320842 4:143389329-143389351 AGTGAGATTGGTGGCAATGTTGG 0: 1
1: 0
2: 1
3: 19
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981320838 Original CRISPR CTCACTAGGTTTTAATTAAA AGG (reversed) Intronic
900722422 1:4186005-4186027 GTGATTAGGTTTTAATGAAATGG + Intergenic
906241901 1:44247485-44247507 CTCACCAGCTTTTAATTAGTCGG - Intronic
906630829 1:47366300-47366322 CCCACTAAGTTTTAATTGCAAGG + Intronic
906926454 1:50122917-50122939 CTCAGTAAGTTTTTATCAAATGG - Intronic
907007545 1:50931025-50931047 TTCTCTAGGTTGTAAATAAAAGG - Intronic
908160209 1:61400024-61400046 CTCTCTTGGTTTTAGTTTAAAGG - Intronic
908591824 1:65644641-65644663 GTGATTAGGTTTTAATGAAATGG + Intergenic
909891976 1:81018606-81018628 CTTACTAGCTTTTATTTCAAAGG - Intergenic
910403544 1:86860735-86860757 CACAACAGGATTTAATTAAAAGG + Intergenic
910740652 1:90512473-90512495 CTCATTGGGTTTTAAGTAAATGG - Intergenic
911520853 1:98928186-98928208 TTTACTTGGTTTTAATGAAAAGG + Intronic
918338728 1:183548985-183549007 CTGACTAGGTTTGATCTAAAAGG + Intronic
918730692 1:187991822-187991844 CTCACTTGGGTTTATTTTAAAGG + Intergenic
918851679 1:189698306-189698328 CTCACTTTGTTCTAATTAATTGG + Intergenic
919041437 1:192393269-192393291 CTCTCTAACTTTTTATTAAAAGG + Intergenic
919140346 1:193562616-193562638 CTCACTAGATTGTAATAAAAGGG + Intergenic
920058823 1:203213643-203213665 CTCAGTCGGTATTAACTAAAAGG + Intronic
921553195 1:216564511-216564533 CTCAATAGGTATATATTAAACGG + Intronic
921580912 1:216895332-216895354 ATCAATAGGTCTTAATTAATAGG - Intronic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
922534021 1:226366614-226366636 CTCCCTGTCTTTTAATTAAAAGG + Intronic
922687745 1:227659246-227659268 CACAATATGTTTTATTTAAATGG + Exonic
1063527552 10:6799862-6799884 GTGACTAGGTTTTAATGAGATGG + Intergenic
1064452137 10:15452280-15452302 CTTACTAGGTACTCATTAAAAGG - Intergenic
1065003595 10:21359655-21359677 ATCTCTAGGTTTTATTTTAAGGG + Intergenic
1065022012 10:21509041-21509063 CTTTCCAGGTTTTAATTAATGGG - Intergenic
1065124208 10:22557949-22557971 GGCACTAGGTTTTAATGCAAAGG + Intronic
1068022070 10:51597406-51597428 CTCAATAGCTCTTAAATAAATGG - Intronic
1068191522 10:53658693-53658715 CACAATAGGTGTTAAGTAAATGG - Intergenic
1068825099 10:61428328-61428350 CTCAATAAGTTTTAATTTATAGG + Intronic
1070525959 10:77296183-77296205 ATCACTAGGTCTTTATAAAAGGG + Intronic
1070815903 10:79323078-79323100 CTTTCTAGCTTTTAACTAAAAGG + Intergenic
1072527988 10:96291174-96291196 TTAACTAGGTTTTAAATAAGTGG + Intergenic
1073034746 10:100555757-100555779 GTGAATAGGTTTTAAGTAAACGG - Exonic
1075254943 10:120918279-120918301 GCCATTACGTTTTAATTAAAAGG - Intergenic
1075328709 10:121556298-121556320 CTCACTAAGTTTAAATTGCAGGG - Intronic
1077781216 11:5331847-5331869 CTCACTAGCTATTTTTTAAATGG + Intronic
1078814342 11:14803966-14803988 GTCAGTAGATTTGAATTAAAAGG - Exonic
1079569416 11:21923806-21923828 CTCACTGGGTTTTCATTTGAAGG - Intergenic
1080667918 11:34351983-34352005 CTCTCTTGGCTTTAATAAAATGG + Intronic
1086602128 11:88646362-88646384 TTCAGTATGTTTTACTTAAATGG - Intronic
1086925466 11:92635505-92635527 CGCATTATGTTTTAATTATATGG + Intronic
1087409455 11:97773061-97773083 ACCAATAGGTTTTATTTAAAAGG + Intergenic
1088614388 11:111609620-111609642 CTCATTAGGATTTAATTTGAAGG - Intronic
1088726619 11:112643578-112643600 CTGAGTTGGTTTTAATTAACTGG + Intergenic
1089877894 11:121743320-121743342 CTCAATAGCTTTAAATTAAAGGG - Intergenic
1093185179 12:16012137-16012159 CTCAGTAAGTGTTAGTTAAATGG + Intronic
1093858331 12:24133126-24133148 CCCACTCTGTTTTAATAAAAAGG + Intergenic
1093863120 12:24192072-24192094 CTTACAAAGTTTTAACTAAATGG - Intergenic
1094364924 12:29670310-29670332 CACAGTAGGTATTCATTAAATGG - Intronic
1099337323 12:81379595-81379617 CTCTCCAGTTTTTAATCAAAAGG - Intronic
1101011755 12:100458171-100458193 CTCATTGGGTTTTAATTACTGGG - Intergenic
1102452273 12:113050706-113050728 CTCATCAGCTTTTAATTAACTGG + Intergenic
1104047151 12:125171527-125171549 CTCACGAGGCTGTAATTAAGGGG + Intergenic
1107967688 13:45612551-45612573 CTGGCTAGCTTTTAATTAAGTGG - Intronic
1108271615 13:48766408-48766430 CTCTCTAGGTTCTCATTATATGG + Intergenic
1108547070 13:51506347-51506369 CTCAGTAGATTTGGATTAAAAGG - Intergenic
1108986450 13:56595107-56595129 CTAAATAGATTTTAATAAAAAGG - Intergenic
1109090538 13:58038068-58038090 CCAACTAGTTTTTAATTATAAGG + Intergenic
1109415932 13:62040310-62040332 CCCAATCGGTTTTAATTTAATGG - Intergenic
1109916738 13:68997988-68998010 TTAAATATGTTTTAATTAAATGG + Intergenic
1109916796 13:68999489-68999511 TTAAATATGTTTTAATTAAATGG - Intergenic
1111541923 13:89679811-89679833 ATCACTATGTTTAAATTTAAAGG - Intergenic
1112161817 13:96876085-96876107 CCTACTAGTTTTTAATTTAAGGG + Intergenic
1112648902 13:101369596-101369618 CTGACTTGGTTTTAATAAAACGG + Intronic
1112668973 13:101613218-101613240 CTTACAAGGTTTTAAGTAGATGG + Intronic
1115937181 14:38565495-38565517 GTCTCAAGGTTTTGATTAAAGGG + Intergenic
1116145706 14:41065577-41065599 CTCACTGGGTTACAAGTAAAAGG - Intergenic
1116616391 14:47145606-47145628 CTTTCTTGGTTATAATTAAAAGG - Intronic
1116622534 14:47224505-47224527 TTCACTAGACATTAATTAAATGG - Intronic
1119068211 14:71552194-71552216 ATCTCAAAGTTTTAATTAAATGG - Intronic
1119243175 14:73079746-73079768 CTCTGTAAGTTTTAATTAACTGG + Intronic
1120259505 14:82163845-82163867 CTTACCAGGTTTTCACTAAAAGG + Intergenic
1125155978 15:36586244-36586266 CCCACAAGGTATTTATTAAAAGG - Intronic
1126539510 15:49806215-49806237 TTCACCAGTGTTTAATTAAAAGG + Intergenic
1126721202 15:51582106-51582128 CCCAGTAGGTTTTTAATAAATGG - Intronic
1131660590 15:94511573-94511595 CTCACTTGGCTATAATGAAAGGG + Intergenic
1137825691 16:51492730-51492752 CTCCATTGATTTTAATTAAAAGG + Intergenic
1138361133 16:56428108-56428130 CTGACTTGGTTTGATTTAAAGGG + Intergenic
1139250554 16:65491305-65491327 CTCCTAAGTTTTTAATTAAATGG + Intergenic
1139931752 16:70532678-70532700 CCTAATAGGTTTTACTTAAAGGG + Intronic
1140798060 16:78459001-78459023 CCCTCTAGGTTGTAATTAATAGG - Intronic
1149181756 17:53947073-53947095 ATTACTAGGTTTGGATTAAATGG - Intergenic
1153031947 18:722061-722083 TTCATTAGGTTTTAACTGAATGG - Exonic
1156896136 18:42248139-42248161 CTCATTAGGTTTTCACTTAAGGG + Intergenic
1158524979 18:58205179-58205201 TTCATTAGGAGTTAATTAAAAGG - Intronic
1159972729 18:74673680-74673702 GTCAGTAGGTATTTATTAAAGGG + Intronic
1160320789 18:77892519-77892541 TTGACAAGGTTTTAATTCAATGG - Intergenic
1163589475 19:18183988-18184010 CTCACTAGTTTTTAAAAAAATGG + Intergenic
1165700593 19:37934055-37934077 CTGAACAAGTTTTAATTAAATGG + Intronic
926372619 2:12195407-12195429 TTCACTAAATTTTAATGAAACGG - Intergenic
926876701 2:17488374-17488396 CTAATTAGGTTTTAAATAATGGG - Intergenic
926877022 2:17492472-17492494 CTAATTAGGTTTTAAATAATTGG - Intergenic
927615274 2:24587704-24587726 CTCTCTTGGTTTTTATTAAGTGG + Intronic
928010718 2:27605041-27605063 CTGACTAGGATTTCATTATATGG + Intronic
931503047 2:62891763-62891785 TTCACTAGGTTTTAAGTTTATGG + Intronic
931805336 2:65798359-65798381 CTCACTCTGTTTAAACTAAACGG - Intergenic
931948382 2:67334546-67334568 CTGATTAGGTTTTAATGAGATGG - Intergenic
932123174 2:69119680-69119702 CTCACGAGGTTGTCATTACAAGG + Intronic
933355462 2:81204940-81204962 TGCATTATGTTTTAATTAAATGG + Intergenic
933891466 2:86775287-86775309 CACTCTAGGTTTTAATTCAAAGG - Exonic
936499292 2:113053099-113053121 CTCCCTAGGCCTTACTTAAAAGG - Intergenic
936499946 2:113059154-113059176 CTCCCTAGGCCTTACTTAAAAGG + Exonic
937092772 2:119217542-119217564 CTTAGTAGGTGTTCATTAAAAGG - Intergenic
937814758 2:126238666-126238688 CTTAATAGGGTTTCATTAAATGG - Intergenic
939280095 2:140052841-140052863 ATTACTATTTTTTAATTAAAAGG + Intergenic
939538907 2:143468560-143468582 ATCTCTAGGATTTAATTATAGGG - Intronic
941300959 2:163800692-163800714 CTCACTAGTTTTTATTTTAAGGG - Intergenic
942173697 2:173310939-173310961 CTTAGTAGGTTTTAACGAAAAGG + Intergenic
942434253 2:175954161-175954183 CTTATTAGCTTTTGATTAAAAGG - Intronic
942795785 2:179817341-179817363 CTCACCAGGTATATATTAAAAGG + Intronic
942852454 2:180505152-180505174 CTCAGTAGGTCTTAAGTGAAGGG + Intergenic
943234871 2:185304670-185304692 TGCACTAGGTTTTACTAAAAGGG + Intergenic
944401657 2:199333821-199333843 CTCATTAAGTTACAATTAAATGG - Intronic
944963592 2:204903702-204903724 CTCTCTACCTTTTCATTAAAAGG + Intronic
947127449 2:226885183-226885205 CTCTTGAGGTTTTGATTAAATGG + Intronic
947229810 2:227873328-227873350 CTCACGAAGTTTACATTAAATGG - Intronic
947481062 2:230500444-230500466 CTCAATAGGTTTTGATTGAAAGG + Intronic
1170967981 20:21093285-21093307 CCCACCACTTTTTAATTAAATGG - Intergenic
1172897529 20:38310967-38310989 CTCACTAGGTATTTGTTGAATGG - Intronic
1174616006 20:51835974-51835996 ATCACTAGATTTTAGTTACATGG + Intergenic
1175167591 20:57055932-57055954 CACCTTAGGTTTTTATTAAAAGG - Intergenic
1177247519 21:18547946-18547968 CTAAGTTGGTTTTAATTTAATGG + Intergenic
1178402435 21:32298375-32298397 CTCTTTTGGTTTTAATTAACTGG + Intronic
1178795961 21:35744541-35744563 CCCTCTAGTTTTTAATTAAGTGG - Intronic
1181840229 22:25651701-25651723 TTCATTAGGTTTTAACTGAATGG + Intronic
1183244419 22:36682863-36682885 CTCACTTTCTTTTAATTGAAGGG + Intronic
952005702 3:28839962-28839984 CTCCCAAGGTTTAAATTAAGAGG - Intergenic
953240595 3:41145624-41145646 CTGAAGAAGTTTTAATTAAATGG - Intergenic
955030851 3:55216318-55216340 CTAAGTAGGTTGAAATTAAAAGG - Intergenic
957128726 3:76196869-76196891 CTCACTAGGTATTAAGTAAATGG + Intronic
957206224 3:77202464-77202486 TTCCCTAAGTTTTAATGAAAAGG - Intronic
957232029 3:77531973-77531995 CTCCATATGTTTTGATTAAATGG + Intronic
957291877 3:78287938-78287960 CTCACAAGGTTTTGTTCAAAGGG + Intergenic
959171731 3:102852394-102852416 CTCAATACCTTTTAATAAAAAGG + Intergenic
960238226 3:115309806-115309828 TTCACTATGTTTTATGTAAATGG + Intergenic
960473112 3:118092605-118092627 CTTACTAGGTATTTATTGAATGG + Intergenic
960852779 3:122073614-122073636 CCCAGCAGGGTTTAATTAAAGGG + Intronic
964144261 3:153440201-153440223 GTCAATAGATTATAATTAAATGG - Intergenic
964158436 3:153615999-153616021 CTCATTAGGTTTTACATAAAGGG + Intergenic
964805617 3:160606661-160606683 CTCCATGGTTTTTAATTAAATGG - Intergenic
964982202 3:162699501-162699523 CTACCAAGGTTTTAATTATAGGG + Intergenic
966742484 3:183247035-183247057 CTCAATAAGTGTTAATTGAATGG + Intronic
967624524 3:191669249-191669271 GTGATTAGGTTTTAATGAAATGG + Intergenic
972508631 4:39745582-39745604 AGCACTAGTTTTTAATTTAAAGG - Intronic
974273176 4:59679333-59679355 TTCACTAGGGTTAAATTCAAGGG + Intergenic
975329943 4:73101220-73101242 TTAACTAGGTTATAATCAAAAGG - Intronic
975354936 4:73391132-73391154 CTCACTAAGTTATTATTAATTGG - Intergenic
977130900 4:93235565-93235587 AACAATAGGTTTTAGTTAAAGGG + Intronic
977270421 4:94911259-94911281 CACACTATGTTTTAATTTAATGG - Intronic
977314544 4:95429254-95429276 ATCACTAAGTATTATTTAAAGGG - Intronic
977667219 4:99654916-99654938 CTCTCAAGTTTTTGATTAAATGG + Intergenic
978944484 4:114479079-114479101 CTGACTGGTTTTTACTTAAAGGG - Intergenic
981125617 4:141102883-141102905 TTCACTAGGTATTACTAAAATGG + Intronic
981320838 4:143389312-143389334 CTCACTAGGTTTTAATTAAAAGG - Intronic
981522138 4:145674083-145674105 GTCAATAGGTATTAATTAAAAGG - Intergenic
983349052 4:166563474-166563496 CTAAGTAGGTTATAATTAAATGG - Intergenic
985330502 4:188826755-188826777 TGGACTAGGTTTTAATTTAAGGG - Intergenic
987752398 5:22057903-22057925 CTCAAAAGGTTTTAATCAAAGGG + Intronic
987752510 5:22059154-22059176 CTCAAAAGGTTTTAATCAAAGGG + Intronic
987813817 5:22874410-22874432 CTCAATAGGTTTAAAATAATGGG + Intergenic
988157528 5:27474182-27474204 CTTACCAGGTTTTACTTTAAAGG + Intergenic
989082613 5:37640417-37640439 TTCACTAGTTTTTAATAAATAGG + Intronic
992053007 5:72957845-72957867 CTCACTATATTATAATAAAAAGG - Intronic
992387199 5:76296090-76296112 CTTAATAGGCTTTAAATAAAAGG + Intronic
992433723 5:76735001-76735023 CTCATTAAGTCTTAAGTAAATGG - Exonic
993176560 5:84494267-84494289 CTTAGTAGGTATTTATTAAAAGG + Intergenic
994936362 5:106258330-106258352 CTCAACAGATTCTAATTAAAAGG + Intergenic
996444621 5:123531904-123531926 CTCAGTAGTTTTTATTTTAATGG + Intronic
998201231 5:140124279-140124301 CTCACTTGGTTTTAAGTATGAGG - Exonic
1000613664 5:163403912-163403934 CTAACTAGTTTTTTATTAAGTGG + Intergenic
1000624405 5:163522756-163522778 TGCAGTAGGTTTTAATTCAAGGG + Intergenic
1001209590 5:169797578-169797600 CTCTTTGGGTTTTAATTGAAAGG - Intronic
1003176760 6:3757821-3757843 CTCACTAAATATTTATTAAATGG + Intergenic
1003698890 6:8440417-8440439 CTCAATAAGTATTTATTAAATGG - Intergenic
1003699183 6:8443543-8443565 CTCACTGGGATGTAATCAAATGG + Intergenic
1004568182 6:16819245-16819267 TTCACTTTGTTTTAATGAAAAGG - Intergenic
1004735729 6:18404536-18404558 CTCACTAGCCTTTTATAAAAAGG + Intronic
1005066346 6:21821518-21821540 ATCACTACATTTTAATTAAGTGG - Intergenic
1005148850 6:22724229-22724251 CTCAGTAGGATTTATTTCAATGG - Intergenic
1007128794 6:39449977-39449999 CTCACTAGGTTTTCATTTTTGGG + Intronic
1008342526 6:50384839-50384861 CCCACTAAGTATTAATTCAAAGG + Intergenic
1009768681 6:68116988-68117010 CTCACTTTGCTTTATTTAAACGG - Intergenic
1010913273 6:81585441-81585463 GCCATTATGTTTTAATTAAAAGG - Intronic
1011243447 6:85297170-85297192 CTCACTTGGTTGAATTTAAATGG + Intergenic
1013057051 6:106593290-106593312 ATAACTAGATTTAAATTAAAAGG + Intronic
1014712737 6:124826880-124826902 CTTAGTAGGTTTTAGTTTAAGGG - Intergenic
1014793864 6:125704630-125704652 GTGATTAGGTTTTAATGAAATGG + Intergenic
1014829310 6:126082763-126082785 TTCTCTAGCTTTTAATTCAAAGG + Intergenic
1014898683 6:126935594-126935616 CAGAGTAGGTATTAATTAAAAGG + Intergenic
1016273696 6:142322578-142322600 TGCATTAGTTTTTAATTAAATGG - Intronic
1016894755 6:149041025-149041047 TTCTTTAGGTTTTATTTAAAAGG - Intronic
1018018119 6:159730862-159730884 GTGAGTAGATTTTAATTAAATGG - Intronic
1018122264 6:160646919-160646941 TTCACTAGGTTTTGAGTACATGG - Intronic
1018501145 6:164412204-164412226 CTCACTCTGTTTTAAGTAGAAGG - Intergenic
1019163026 6:170081451-170081473 CTCACTTGTTTTTAAGAAAAGGG - Intergenic
1020460288 7:8422563-8422585 TTCCATATGTTTTAATTAAATGG + Intergenic
1022240757 7:28510395-28510417 CTCATTAGGTTTTAGTAAAGTGG + Intronic
1022242555 7:28527097-28527119 CTAACCAGGTTTTCACTAAAGGG - Intronic
1024692571 7:51818952-51818974 CCCTCTTGGGTTTAATTAAAGGG - Intergenic
1027392751 7:77721932-77721954 CTCACTAGCTTTTAAAAGAAAGG - Intronic
1027554938 7:79652241-79652263 ATCACTCTCTTTTAATTAAAAGG - Intergenic
1027754782 7:82198818-82198840 CACATTAGTTTTTAATAAAAAGG - Intronic
1029064049 7:97830375-97830397 CTCAATACGTGTTAATTTAATGG - Intergenic
1029293642 7:99521561-99521583 CTCACAAGCTTTTATTTAACAGG + Intronic
1029878846 7:103784156-103784178 ATCACAAAGTTTTAATGAAAGGG + Intronic
1031685968 7:124731975-124731997 CTGATTAGGTTTTAATGAGATGG - Intergenic
1031727814 7:125261674-125261696 GTGATTAGGTTTTAATGAAATGG + Intergenic
1033416277 7:141164140-141164162 TTTACTTGGTTTTCATTAAAAGG - Intronic
1033769109 7:144528459-144528481 AACACTAGGTTTAAATTAAAAGG - Intronic
1034009968 7:147519158-147519180 CTCACTAGGTTAAAATCAACAGG + Intronic
1036031303 8:4977221-4977243 CTCACTTGGCTTTTATTGAAGGG - Intronic
1036063537 8:5353132-5353154 CTTCCTAGTTTTAAATTAAAAGG - Intergenic
1037601045 8:20394303-20394325 GTAAATAGGTTTTAATTAGACGG - Intergenic
1040114470 8:43600159-43600181 CTTTCTAGTTTTTAATCAAAGGG - Intergenic
1040529610 8:48255947-48255969 ATCACCAGGTGTTAATTAGAGGG + Intergenic
1043921891 8:85992779-85992801 CTAAAAAGGTTTTAACTAAAAGG + Intronic
1044231087 8:89778977-89778999 CTCACTAAAATATAATTAAAAGG - Intronic
1046146531 8:110168411-110168433 CGCAATAGATGTTAATTAAAGGG + Intergenic
1046380287 8:113441030-113441052 CTCACATGTATTTAATTAAAAGG + Intergenic
1048230526 8:132636138-132636160 CTCACAAGCTTTCAATGAAATGG + Intronic
1048247206 8:132819496-132819518 CACACAAGGTTGTAATCAAAAGG - Intronic
1048434642 8:134404799-134404821 CTCACTAGCTTATAATTGACAGG - Intergenic
1051154003 9:14120279-14120301 CTCAATAAGTTTTTATTTAAAGG - Intronic
1051183229 9:14433073-14433095 CCCACTATGTTTTAAATAAGGGG - Intergenic
1052799462 9:32954616-32954638 CTCTTTGGGTTTTAAATAAAGGG + Intergenic
1053392105 9:37743235-37743257 CTCATTAGGTATTCACTAAAAGG - Intronic
1056433045 9:86547603-86547625 CTTCCTGGCTTTTAATTAAAGGG + Intergenic
1057537531 9:95927816-95927838 CTCATCTGGTTTTAATAAAAAGG - Intronic
1058360152 9:104136093-104136115 TTCAGGAGGTTTTAATTAATTGG - Intronic
1185858306 X:3555899-3555921 GTGACTAGGTTTTAATGAGATGG + Intergenic
1187027262 X:15448521-15448543 CTCACAAGGTTTTAAATAGTAGG - Intronic
1187630431 X:21163436-21163458 CTAACTAGATTTTAATTAAAAGG + Intergenic
1191931766 X:66381298-66381320 CTCAATACGTTTTAAATCAATGG + Intergenic
1192032002 X:67523876-67523898 CTCATTAGGTTTTCAGTAAAGGG - Intergenic
1193438734 X:81512762-81512784 TTCCCTAGGTTTTTCTTAAACGG - Intergenic
1193718114 X:84955381-84955403 CTCAGTTGGATATAATTAAAGGG - Intergenic
1195528197 X:105919303-105919325 CTCACCAGATTTTAATCACAGGG + Intronic
1196907483 X:120451896-120451918 CTCCCTTTGTTTTAAATAAAAGG + Intronic
1197092122 X:122551617-122551639 CTCAATATGTTTTGATTAAAGGG - Intergenic
1197780532 X:130155027-130155049 TTCTCTAGGTGTTTATTAAAGGG - Intronic
1200611017 Y:5327556-5327578 GTGACTAGGTTTTAATGAGATGG + Intronic
1201061555 Y:10051090-10051112 CTGATTAGGTTTTAATGAGATGG + Intergenic