ID: 981325528

View in Genome Browser
Species Human (GRCh38)
Location 4:143442403-143442425
Sequence TGTGCTCTACAGAGCTCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981325528_981325532 21 Left 981325528 4:143442403-143442425 CCCCTTGAGCTCTGTAGAGCACA 0: 1
1: 0
2: 1
3: 13
4: 150
Right 981325532 4:143442447-143442469 TCAACAGTTGTGATTCCATGTGG 0: 1
1: 0
2: 0
3: 4
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981325528 Original CRISPR TGTGCTCTACAGAGCTCAAG GGG (reversed) Intronic
900653250 1:3741729-3741751 TGAGCTCTCCAGAGCACAGGTGG - Intergenic
903647636 1:24904684-24904706 TGTGCCCCTCAGAGCTCACGCGG + Intronic
904962196 1:34342521-34342543 TGTGCTCTACACAACTCTAGGGG + Intergenic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
906605132 1:47164008-47164030 TGTTCCCTGCAGAGCTCTAGGGG + Intergenic
908084891 1:60621194-60621216 AGGGCTCTACAGAGCACAAAGGG - Intergenic
909585624 1:77284220-77284242 TGTGCTATGCGCAGCTCAAGAGG + Intronic
910356188 1:86359120-86359142 TGTAGTCTTCAAAGCTCAAGTGG - Intronic
910694827 1:90000926-90000948 TGTGTTCTAGAGACATCAAGGGG + Intronic
910906043 1:92179851-92179873 TGTGCTCTACATAGCTGAAAAGG - Intronic
916872625 1:168933328-168933350 TCTGCTGTTCAGAGCCCAAGGGG + Intergenic
917754787 1:178088292-178088314 TATGCTTTACAGAGCTTAAAAGG - Intergenic
918323016 1:183382797-183382819 TGTACCCTGCAGAGCTAAAGGGG - Intronic
921674811 1:217965578-217965600 TGTGCTCTGCAGAGCCAGAGGGG - Intergenic
921857256 1:220000323-220000345 TGTGGTCCACAGACCCCAAGGGG + Intronic
1067793931 10:49307308-49307330 TGTTCTCTGCAGACCTCAAGGGG - Intronic
1069109222 10:64424531-64424553 TGTGCACTACACAGCTCCATGGG + Intergenic
1069885892 10:71623392-71623414 TGTCCAGGACAGAGCTCAAGAGG + Intronic
1072376590 10:94822987-94823009 TGTACTCTACATAGCTTAAAGGG - Intronic
1072765791 10:98094159-98094181 TGGCCTCTTCAGAGCTCAAATGG + Intergenic
1075617917 10:123904938-123904960 TGTGCTTCACAGAGCACAGGAGG - Intronic
1076761935 10:132610330-132610352 TGGGCTCCACAGAGCTGCAGGGG - Intronic
1077698558 11:4418342-4418364 TGTGCTGCACAGAGATCAAAGGG - Intergenic
1082687833 11:56260956-56260978 TGTGCTCCACAGAGCCAGAGTGG - Intergenic
1085764010 11:79266626-79266648 TGTGCACTAAAGAGTTTAAGAGG + Intronic
1086510542 11:87553150-87553172 TGTGCTCAACTGGGCTCAGGAGG - Intergenic
1087924551 11:103904235-103904257 TGTGCACTACAAATCTCTAGGGG - Intergenic
1088817921 11:113434004-113434026 TGTGCTATGCTGAGCCCAAGTGG - Intronic
1089403947 11:118181903-118181925 TGTGCTCTGCAGATCACCAGAGG - Intergenic
1095964270 12:47856710-47856732 AGTGGTCCCCAGAGCTCAAGTGG + Intronic
1099178023 12:79444558-79444580 TTTGCTCTAAAGATCTCATGGGG - Intronic
1103367707 12:120395055-120395077 TGTGTTTTCCAGAGCCCAAGGGG - Intergenic
1107399561 13:40056041-40056063 AGTGCTCTACTGAGATCAGGAGG + Intergenic
1108077912 13:46700794-46700816 TGTGCTTTACTGAGTTCTAGGGG - Intronic
1110709203 13:78631523-78631545 TTTGATCTTCAGAGCTCAAGGGG - Intronic
1111218763 13:85178411-85178433 TGTGCTCTGCAGAGCTACAGAGG - Intergenic
1114168570 14:20247824-20247846 TGTGCTCTACTGACCTCTAATGG + Intergenic
1117296687 14:54386852-54386874 TGTGCTGTACAGAGCGCAGGGGG - Intergenic
1118431428 14:65722646-65722668 TGGGCTCTATAGAGATGAAGTGG - Intronic
1118873195 14:69760532-69760554 AATTCTCTACAGAGCTCAACAGG + Intronic
1119191671 14:72687106-72687128 TGTACTCTGCAGAGCTGAAAGGG - Intronic
1119591174 14:75889415-75889437 TGTGCCCTACAGAGATCTTGTGG + Intronic
1120927669 14:89814160-89814182 TGTTCTGTACAGTGCTCTAGAGG - Intronic
1120944107 14:89977634-89977656 TGTTCTTGACACAGCTCAAGAGG + Intronic
1120992757 14:90392645-90392667 TGAGGTCTAGAGAGGTCAAGAGG - Intergenic
1125318693 15:38459114-38459136 TGTCCTCAAAAGAGCTCACGTGG - Intronic
1126026206 15:44448334-44448356 TGTGCTCCACAAAGCCCATGCGG + Intronic
1126413053 15:48392151-48392173 TTTACTGTACAAAGCTCAAGTGG + Intergenic
1129509321 15:76109036-76109058 TGTGCTTTCCACAGCTCATGTGG - Intronic
1132298691 15:100763368-100763390 TGTCCTCTGCAGAGCTGAAATGG - Intergenic
1133745362 16:8682427-8682449 TGTGCTAGACAGAGATAAAGGGG - Intronic
1134098297 16:11434122-11434144 TGAGCTCTCCAGAGCTGGAGTGG - Intronic
1140577597 16:76189602-76189624 TTTGGTCCACAGAGCTAAAGGGG - Intergenic
1150619913 17:66800359-66800381 TGAGGTCTGCAGAGCTAAAGGGG - Intronic
1151074361 17:71254296-71254318 TTTGCTCTACAGCCCTCAAGTGG + Intergenic
1152784894 17:82242439-82242461 TGTGCACAACAGAGCCCAAGGGG + Intronic
1155087135 18:22469824-22469846 TGTGTTTTACAGAGCTGATGGGG - Intergenic
1155520067 18:26658411-26658433 AGTGCTCAACAGAGCTCGACAGG + Intergenic
1156510376 18:37631586-37631608 ACTTCTCTAGAGAGCTCAAGGGG + Intergenic
1157449697 18:47776090-47776112 GGCGCTCAACAGAGCTCAACAGG + Intergenic
1158573010 18:58612649-58612671 TGTGCCCTGCAAAGCTCCAGTGG - Intronic
1159947951 18:74457674-74457696 TGCGCTCTACAGAGCGCTGGGGG - Intronic
1160045516 18:75383391-75383413 TGTTTTTTGCAGAGCTCAAGGGG + Intergenic
1160555976 18:79725618-79725640 TGTGGTCTAGAGAACTCGAGCGG + Intronic
1166325238 19:42045910-42045932 TGTGCTAGACTGAGCTCAAGTGG + Intronic
925647746 2:6054322-6054344 TGTGCTCTAAAGAGATGCAGGGG + Intergenic
928132597 2:28663642-28663664 ACTGGACTACAGAGCTCAAGAGG + Intergenic
928879576 2:36082991-36083013 TCTGCTCTAGAGAGCTGAATTGG + Intergenic
933635569 2:84704964-84704986 TGTGCTCTGCAGAGCTCTCTGGG - Intronic
934637782 2:96006856-96006878 TGTGCTCTGCACAGCTCCAGGGG + Intergenic
934795879 2:97098555-97098577 TGTGTTCTGCACAGCTCCAGGGG - Intergenic
936116069 2:109704211-109704233 TGTGCTGTGCAAAGCTCAGGGGG - Intergenic
939163866 2:138619422-138619444 TTTGTTCTACAAATCTCAAGGGG - Intergenic
941227172 2:162864799-162864821 TGTGCTCTGCAGAGCCACAGGGG - Intergenic
945357467 2:208856999-208857021 TGTGCTTTCCCCAGCTCAAGGGG + Intergenic
946729418 2:222694072-222694094 TGTGCACTACTGAACTCTAGAGG - Intronic
947197678 2:227584803-227584825 TTTGGTCTACAGAGGACAAGAGG + Intergenic
947940642 2:234051954-234051976 TGTGCTCTACAGAGTAGCAGAGG - Intronic
1169183322 20:3590433-3590455 TGTGCACTGCAGAACTCTAGGGG - Intronic
1173235747 20:41244105-41244127 TGTGCTCTACTGGGATCTAGTGG - Intronic
1178771460 21:35508619-35508641 TGTGCACTGCACAGCTCCAGGGG - Intronic
1181310384 22:21941524-21941546 TGTGTTCCACGGAGGTCAAGAGG + Intronic
1184609427 22:45593267-45593289 TGTGGACCACAGAGCCCAAGAGG + Intronic
951492195 3:23283784-23283806 TGTGCTCTCCAGAGGTCACGTGG + Intronic
951515962 3:23559948-23559970 TGTGCTCTTTAGAGGCCAAGAGG + Intronic
951554532 3:23907468-23907490 TGTGGTCTGCAGATCTCATGAGG + Intronic
952181583 3:30921902-30921924 TGTGCTTTAGGGACCTCAAGGGG + Intergenic
952336024 3:32403663-32403685 TGTCCTTTTAAGAGCTCAAGTGG - Intronic
953602936 3:44386406-44386428 CGTGCTCTACAGAGCTGGTGTGG + Intronic
953988080 3:47461001-47461023 TGTGCTGGAGAGAGCTCTAGGGG - Intronic
956964766 3:74445903-74445925 TGTGCACTGCACAACTCAAGAGG + Intronic
957612012 3:82480391-82480413 TGTGCTATACACAGCTTTAGAGG + Intergenic
958782664 3:98561813-98561835 TATGCTCCACAGAGCTCTACAGG + Intronic
960590636 3:119362237-119362259 TGTGCTGTGCAGGGCACAAGTGG - Intronic
961360440 3:126364109-126364131 TGTGGACAACAGTGCTCAAGAGG - Intergenic
961592366 3:127990499-127990521 CATGCTCTGCAGAGCTGAAGGGG - Intergenic
961752929 3:129107896-129107918 TTTGCTCTAGAGAGTTGAAGAGG - Intronic
962948210 3:140193152-140193174 TGTGATTTAAAGAACTCAAGAGG + Intronic
963268550 3:143263540-143263562 TGTGATGTACAAAGCTCAAAAGG + Intergenic
963622122 3:147623777-147623799 TGTGCTGGAGAGAGGTCAAGTGG + Intergenic
966210956 3:177452920-177452942 TGTGGACTACACAGTTCAAGTGG - Intergenic
967084111 3:186078719-186078741 TGTGTTACACAGGGCTCAAGGGG - Intronic
967567452 3:190988787-190988809 TGTACTCTACAGAGCCACAGAGG + Intergenic
975190559 4:71455993-71456015 TGTGTTCTAAAGATTTCAAGAGG + Intronic
976782681 4:88778448-88778470 TGTGCACTGCAGTGGTCAAGAGG - Intronic
977984011 4:103360605-103360627 TGTGCTCTGCAGAGCCACAGGGG + Intergenic
978157432 4:105505880-105505902 TGTGTTCTTCTTAGCTCAAGGGG + Intergenic
981325528 4:143442403-143442425 TGTGCTCTACAGAGCTCAAGGGG - Intronic
982055477 4:151544988-151545010 TTTGCCCTCCAGGGCTCAAGTGG - Intronic
984886398 4:184453821-184453843 TGAGCTCCACAGACCTCAAAAGG + Intronic
991232042 5:64345271-64345293 TGTGCACTGCGGAGCTCCAGAGG - Intronic
992552511 5:77872267-77872289 TGTTCTCCACAGAGCTGTAGTGG + Intergenic
992632288 5:78693296-78693318 CCTGCTCTAGAGAGATCAAGTGG - Intronic
993532696 5:89043764-89043786 TGTGGTCTACTGAGCTGAAATGG - Intergenic
993850747 5:93005049-93005071 TGAGATCAAAAGAGCTCAAGTGG + Intergenic
996568897 5:124910918-124910940 TGTGCTCTCCAAAGATCAAAGGG - Intergenic
997635742 5:135403853-135403875 TGTGCTCTGCAGACCACAATGGG + Intergenic
1000509290 5:162162432-162162454 TGTTCTCTACAAATCTCATGTGG + Intergenic
1001688057 5:173610509-173610531 TGTGCCCTTCAGTGCTCTAGTGG - Intronic
1003524426 6:6886136-6886158 TGTGCTGTACAAGGCTCAAAAGG + Intergenic
1004916292 6:20335099-20335121 CTTGGTCTACAGAGCTCAACTGG + Intergenic
1005312553 6:24572299-24572321 TCTGCTCTGGAGAGCTCCAGGGG - Intronic
1006645136 6:35510628-35510650 TCTGCCTCACAGAGCTCAAGGGG + Intronic
1007119563 6:39368822-39368844 TTTGCTCTACAGAGGCCCAGAGG - Intronic
1007266132 6:40597486-40597508 TGAGGTCTACAGAGCGGAAGTGG - Intergenic
1009639106 6:66307353-66307375 TGTACTCTATAGACCTCAAGAGG + Intergenic
1009651201 6:66479880-66479902 GGTGCTCTACGTTGCTCAAGCGG + Intergenic
1015016437 6:128418911-128418933 AGTGCTTTACAGAGCTAGAGGGG - Intronic
1016135094 6:140531709-140531731 TGCTCTCTACATAGCTGAAGAGG - Intergenic
1017280674 6:152620967-152620989 TGTGCTATAAAGAGCTAGAGGGG + Intronic
1019704956 7:2493223-2493245 CGTGCTGTGCTGAGCTCAAGTGG - Intergenic
1021914109 7:25414438-25414460 TGGGCTTTACAAACCTCAAGAGG + Intergenic
1022562789 7:31366990-31367012 TGTGCTCTGCAGAGTCCAAAAGG + Intergenic
1024100777 7:46030601-46030623 TGTGCTCCACAGAGCTGCAAGGG - Intergenic
1030080139 7:105770563-105770585 TGTGCTGTGCTGACCTCAAGAGG + Intronic
1035416781 7:158695875-158695897 TGTGCTGTACAGAGCGCACCAGG + Intronic
1036284810 8:7434796-7434818 TGTGCTCTGCAGAACTGCAGAGG - Intergenic
1036336664 8:7876734-7876756 TGTGCTCTGCAGAACTGCAGAGG + Intergenic
1038371665 8:26999476-26999498 TGTGGTCTACTCAGCGCAAGAGG + Intergenic
1038658775 8:29478486-29478508 TGTTCTTAACACAGCTCAAGGGG - Intergenic
1039257151 8:35732259-35732281 TCTGCTGTACAGGGCTCGAGAGG + Intronic
1041767962 8:61439576-61439598 TCTGCTTAATAGAGCTCAAGTGG - Intronic
1045436950 8:102173354-102173376 TGTACCCTACAAAGCTGAAGGGG - Intergenic
1046187137 8:110735274-110735296 TGTGCTCCACAGAGCCAGAGGGG - Intergenic
1052517066 9:29495677-29495699 TGTGCTGAAAAGAGCTGAAGAGG - Intergenic
1054795109 9:69294235-69294257 TTTGCTTTAAAGAGCTCCAGTGG + Intergenic
1054942788 9:70761783-70761805 TGAGAAATACAGAGCTCAAGAGG + Intronic
1055192460 9:73542032-73542054 TGTGCTCTACACAGCTCCAGGGG - Intergenic
1056442646 9:86636068-86636090 TGTTCTCTACAGAATTCTAGAGG - Intergenic
1057725928 9:97568116-97568138 TGAGCACTACAGAGCAGAAGAGG - Intronic
1059443720 9:114325300-114325322 TGAGCTCTACAGAGGCCCAGGGG + Intronic
1059444921 9:114332077-114332099 TGAGCTCTACAGAGGCCCAGGGG + Intronic
1061182976 9:129035992-129036014 TAAGCTCTAGAGAGCTGAAGTGG + Intergenic
1185710340 X:2298432-2298454 TGTTCACTACAGAGCTAAAATGG - Intronic
1185841338 X:3394541-3394563 TGTCCTCTCCAAAACTCAAGTGG + Intergenic
1190729148 X:53213437-53213459 TCTGCTCTACAGAAATCCAGAGG + Intronic
1191710939 X:64149499-64149521 TGTACTCTACAGAGCCACAGGGG - Intergenic
1194369609 X:93056260-93056282 TGTGCTTTACAGATATAAAGAGG - Intergenic
1194563066 X:95447069-95447091 TGTGCCCTACAGAGCCACAGGGG - Intergenic
1195177105 X:102322197-102322219 TCTCCTCTACAGACCTGAAGGGG + Exonic
1195181759 X:102364896-102364918 TCTCCTCTACAGACCTGAAGGGG - Exonic
1196943870 X:120805198-120805220 TATGCTCTGCAGAGCCCTAGGGG + Intergenic
1197326372 X:125099249-125099271 TCTTCTCAACAGAGCTTAAGGGG - Intergenic
1197692794 X:129522003-129522025 TATGCTTTAGAGATCTCAAGTGG - Intronic
1199864664 X:151831965-151831987 TGTTCTCTACAGAGCTTACTAGG - Intergenic