ID: 981326610

View in Genome Browser
Species Human (GRCh38)
Location 4:143455673-143455695
Sequence CTGAATTTACAGATGTGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981326610_981326612 7 Left 981326610 4:143455673-143455695 CCAAGCCACATCTGTAAATTCAG 0: 1
1: 0
2: 0
3: 17
4: 204
Right 981326612 4:143455703-143455725 TCAACTATAGACATAAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981326610 Original CRISPR CTGAATTTACAGATGTGGCT TGG (reversed) Intronic
901164251 1:7206007-7206029 CTGAGTTTCCAAATGTGGTTGGG + Intronic
902398426 1:16144695-16144717 CTCATTTTACAGATGGGGGTGGG + Intronic
903126380 1:21251024-21251046 CTGAATTTGCAGATGGGGTAAGG + Intronic
904801058 1:33093210-33093232 CTTGATTGAGAGATGTGGCTGGG + Intronic
907178697 1:52551771-52551793 CTGAATTATCATATCTGGCTGGG + Intronic
908913965 1:69104532-69104554 CTGAATTTCCAAATGCGGCTAGG + Intergenic
909227279 1:73041744-73041766 CTGAATATACAGACCTTGCTAGG + Intergenic
910229273 1:84969273-84969295 CAGAAGTTCCAGAGGTGGCTGGG + Intronic
910373980 1:86549357-86549379 CTGAAGTTAGAGAGGTGGCAGGG + Intronic
910842662 1:91575653-91575675 CAGAATTTGCAGCAGTGGCTGGG + Intergenic
914833122 1:151185419-151185441 TTAAATTTACTGATGTTGCTGGG - Intronic
917680404 1:177360398-177360420 CTGGATGTAAAGATGTGGCTTGG + Intergenic
918963756 1:191313223-191313245 TAGAATTTACTCATGTGGCTGGG + Intergenic
919639960 1:200037832-200037854 CTGAATTGCCAGGTGTGGGTGGG + Intronic
921285465 1:213605405-213605427 CTGAATTTTCAGCAGTTGCTAGG - Intergenic
922650262 1:227331841-227331863 CTGAAAGAATAGATGTGGCTGGG - Intergenic
923880941 1:238103642-238103664 CTGAATTTACAGATGTGAAGGGG + Intergenic
924020325 1:239774262-239774284 CTCTTTTTACAGCTGTGGCTGGG + Intronic
924945836 1:248846495-248846517 CTGAAGTTACTGAAGGGGCTGGG - Intronic
1063586834 10:7359507-7359529 CTTAAATTACATATGTTGCTGGG + Intronic
1063955435 10:11261258-11261280 CTGAAACTACTGATGTGGCAGGG - Intronic
1064941559 10:20741236-20741258 CTGAAGTTACTGATATGGTTTGG + Intergenic
1068766701 10:60772222-60772244 TTCAATTATCAGATGTGGCTGGG + Intergenic
1070488350 10:76952223-76952245 CAGAATGTACATATATGGCTGGG + Intronic
1072110109 10:92311123-92311145 TTTAATTTACAGAAGTTGCTGGG + Exonic
1073935693 10:108628866-108628888 CTGAATTTATAGAAGTGGAGTGG + Intergenic
1074518626 10:114196722-114196744 CAGAATTTTAAGATGTGTCTTGG + Intronic
1075077750 10:119362348-119362370 CTGAATGGCCTGATGTGGCTAGG + Intronic
1075411601 10:122232535-122232557 CTGAAATAAAAGAGGTGGCTTGG - Intronic
1075478516 10:122757644-122757666 TTAAATTTAAAGATATGGCTGGG - Intergenic
1078007681 11:7544830-7544852 CTGATTTTTCACATGTCGCTTGG + Intronic
1078540129 11:12206582-12206604 CTGAGGCTAGAGATGTGGCTGGG - Intronic
1079270728 11:18983286-18983308 CTGCATTTCCAGATGTTCCTGGG - Intergenic
1080485617 11:32704181-32704203 CTGGGTTTAGAGCTGTGGCTGGG - Intronic
1081069032 11:38586158-38586180 CTGAATTTTCAGATTTGTCAGGG - Intergenic
1084067841 11:66715539-66715561 CTGAGCTTACAGATGAGGCTTGG + Intronic
1084655727 11:70516771-70516793 CTGAATATAAAAATGGGGCTGGG + Intronic
1085251982 11:75150118-75150140 CTGATTTTACAAATGAGGCATGG - Intronic
1085751923 11:79169280-79169302 CTTAATTCACAGATGTGCCAGGG - Intronic
1085831384 11:79904960-79904982 CTGAATTTAGAGATGGGGAGAGG - Intergenic
1087180129 11:95133817-95133839 CTGAAGGTACAGATGAGGGTTGG + Intergenic
1090998732 11:131890299-131890321 CTGAATCTACAAATGCTGCTAGG + Intronic
1092515325 12:9205560-9205582 CTGATTTTACTGATTTGGCATGG - Intronic
1093064992 12:14648253-14648275 TTTAATTTAAAGATGAGGCTAGG - Intronic
1095668919 12:44835421-44835443 CAGACTTTCCAGATGTGGATGGG + Intronic
1096141412 12:49245809-49245831 CTGAGGTTACAGTTCTGGCTGGG + Intronic
1097229556 12:57501522-57501544 CTGAAAATACAGAAATGGCTAGG + Intronic
1100076038 12:90785172-90785194 CTGAAATTATAGATTTGACTGGG - Intergenic
1100796927 12:98192017-98192039 CTGAAGTTACAGATGTGAATGGG + Intergenic
1101382063 12:104222239-104222261 TTGAATGTATAGAAGTGGCTGGG + Intronic
1102828147 12:115968389-115968411 TTGATTTTACAGATGTGTCCAGG - Intronic
1104220548 12:126780441-126780463 TTGAATGTACAGAGGTGCCTTGG + Intergenic
1105660306 13:22487093-22487115 CTGGATTTACAGATGTCTCCTGG + Intergenic
1106352246 13:28943471-28943493 CTGAGTTGCCAAATGTGGCTAGG + Intronic
1106514010 13:30437372-30437394 CTGAATTGCCAGCTCTGGCTAGG - Intergenic
1107638453 13:42416778-42416800 CTGACTTTGCAGATGTGATTAGG + Intergenic
1107702916 13:43066516-43066538 CTGACTTTGCAGATGTGATTAGG - Intronic
1108866422 13:54928942-54928964 TTGAAATTATAGAAGTGGCTAGG + Intergenic
1109186027 13:59269602-59269624 TTGGATTTACAAATGTGGTTGGG - Intergenic
1110174639 13:72541386-72541408 CTGATTTTACTGGTGTGGCAAGG + Intergenic
1112105739 13:96237285-96237307 ATGCATTTACAGATTTGGTTAGG - Intronic
1114898163 14:27020795-27020817 ATGGATTTATAAATGTGGCTGGG + Intergenic
1117125738 14:52623170-52623192 ATGAATGTACAGATGTGGCAGGG - Intronic
1118183054 14:63512788-63512810 CTTAATTTATAGAGGTAGCTTGG - Intronic
1118289385 14:64505312-64505334 CTCAACTTACAGCTGCGGCTCGG + Intronic
1119406674 14:74403337-74403359 CTGAATTTGCAGCTGAGGGTAGG + Intergenic
1119643514 14:76331321-76331343 GTGAATTCACAGATGGGGCCAGG - Intronic
1119689898 14:76663411-76663433 CTTAAATCACAGATCTGGCTAGG + Intergenic
1120675965 14:87421695-87421717 CTGTACTTACCAATGTGGCTAGG - Intergenic
1121717657 14:96087815-96087837 CAGAATTTAAGGAAGTGGCTTGG - Exonic
1122711283 14:103660183-103660205 TTGATTTAAAAGATGTGGCTGGG + Intronic
1124497884 15:30197595-30197617 ATGAATTTCAAGATGTGGCCTGG - Intergenic
1126687011 15:51257239-51257261 TCCACTTTACAGATGTGGCTTGG + Intronic
1127237380 15:57069627-57069649 CTGTATGTAGAGATTTGGCTAGG + Intronic
1127669751 15:61183987-61184009 CTGAATTAACAGATGAGGAGAGG - Intronic
1128197803 15:65775917-65775939 CTGAATTTGCAAAGGTGGCATGG - Intronic
1129497772 15:76002487-76002509 ATGAACTTACTGATATGGCTAGG - Intronic
1130811737 15:87386191-87386213 CTGAATTTAAAGATGTGATATGG - Intergenic
1133135739 16:3710286-3710308 CCTAGTTTGCAGATGTGGCTGGG - Intronic
1133846584 16:9459813-9459835 AAGAATTTACATATGTGGCAGGG - Intergenic
1133861158 16:9596892-9596914 CTCAACCTCCAGATGTGGCTAGG - Intergenic
1133925080 16:10185683-10185705 TTTAAAATACAGATGTGGCTGGG + Intergenic
1134078530 16:11308973-11308995 CTGAATCTGCAGCTGTGGTTTGG + Intronic
1135332187 16:21569963-21569985 ATGAATTTCCATATGTGGATTGG + Intergenic
1137253807 16:46759054-46759076 CTGACTTTACAGAAGTGGAGAGG + Intronic
1139498886 16:67344110-67344132 ATAAAATCACAGATGTGGCTGGG - Intronic
1139502529 16:67379122-67379144 CCAAATTTACAATTGTGGCTGGG + Intronic
1142078982 16:88137846-88137868 CTGGGTTTGCAGATTTGGCTGGG + Intergenic
1143085699 17:4414318-4414340 CTGAGATTACAGGTGTAGCTGGG - Intergenic
1144378468 17:14669135-14669157 CTGCATTTACAGCTCAGGCTTGG - Intergenic
1147062254 17:37889934-37889956 CTGAATCTCCAGATGAGGTTAGG + Intergenic
1149956340 17:61054880-61054902 CTGGATTAACAAATTTGGCTGGG + Intronic
1150121712 17:62608916-62608938 CTTGGTTTACAGATGTGGCAAGG - Intronic
1152043495 17:77920418-77920440 CTAAAAATACAGATGTGGCCAGG + Intergenic
1152432427 17:80256524-80256546 CAAAATTTAAAAATGTGGCTGGG - Intergenic
1152661074 17:81542401-81542423 CTAAATTTCCAGATGAGCCTGGG + Intronic
1152720088 17:81919235-81919257 CCGACTTTCCAGATGTGGATGGG + Exonic
1153867672 18:9287849-9287871 ATGAAATTCCAGCTGTGGCTGGG - Intergenic
1155773608 18:29730722-29730744 TTAAATTTTCACATGTGGCTAGG + Intergenic
1159066733 18:63576930-63576952 CTCAATTTCCATATGTGGTTAGG + Intergenic
1162696663 19:12482028-12482050 CTGGGATTACAGATGTGGCTTGG - Intronic
1163624646 19:18382235-18382257 CTGATGTTACAGATGTTGTTGGG + Intronic
1164857769 19:31538417-31538439 CTGGATTTACAGGTGAGGGTGGG - Intergenic
1166196150 19:41207149-41207171 CTGCAGTTGCAGAGGTGGCTGGG - Exonic
1168523019 19:57067707-57067729 CTTAATTTACAGAGGTGGCCCGG - Intergenic
927420438 2:22925325-22925347 AAGAATTTAGAGATGAGGCTGGG - Intergenic
927808926 2:26171487-26171509 CTGGAATTACATATGTAGCTGGG - Intergenic
929283203 2:40105863-40105885 CTGAATTACCAGATGTGGTCAGG - Intronic
932243661 2:70178304-70178326 TTGAATTTAAAAATGTGGCCTGG + Intronic
935863421 2:107359191-107359213 CTCATTTTACAGAGGTGGATGGG + Intergenic
936232496 2:110715502-110715524 CTGGTTATACAGATGTGCCTAGG + Intergenic
937009939 2:118553425-118553447 GTCAATTTACAGAGGTGTCTAGG + Intergenic
938105142 2:128525137-128525159 CTGAAGTTTGAAATGTGGCTGGG + Intergenic
938760961 2:134425640-134425662 CTGACCTGACAGATGTGGCTTGG - Intronic
939098491 2:137865301-137865323 CTCAATTGACTGATGTGACTAGG - Intergenic
941173984 2:162174592-162174614 CTGATTTTAAAGATTTGGTTCGG + Intronic
942039790 2:172048253-172048275 CTGAATTTTAAAATGTGCCTTGG - Intronic
942686101 2:178533607-178533629 CTGAATATACTGTTGTGGCAAGG - Exonic
943963831 2:194304540-194304562 CTCAATCTACACATGTGGTTAGG - Intergenic
945344296 2:208694583-208694605 CAGAATTTGTAGGTGTGGCTTGG + Intronic
946411539 2:219517583-219517605 CTGGAATTACAGATTGGGCTGGG + Intronic
948956771 2:241299147-241299169 CTGAATTTACAGAGGAGGTACGG - Intronic
1170371660 20:15655445-15655467 CTGAATTTTCACAAGTGGTTTGG + Intronic
1172071201 20:32258516-32258538 CTGAAATTATAGGTGTGGCCTGG + Intergenic
1173143475 20:40505067-40505089 CTAAATTTACAGATGCAGATAGG - Intergenic
1173432659 20:43004076-43004098 CTGAATTTATATTTTTGGCTTGG - Intronic
1173620753 20:44434204-44434226 CCCACTTTACAGATGAGGCTCGG - Intergenic
1181574656 22:23786218-23786240 ATGAAATTGCAGCTGTGGCTGGG - Intergenic
1183491548 22:38119336-38119358 CAGACTTCACAGATGGGGCTGGG + Intronic
1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG + Intergenic
1184975155 22:48056451-48056473 CTGAATTTACAGGTGAGGGTGGG - Intergenic
950168808 3:10822157-10822179 CAGAGATTACAGATGTGGTTTGG + Intronic
950281374 3:11710802-11710824 AAGAATTTAGAGATGTGGCTGGG + Intronic
953330127 3:42045709-42045731 TTGAATTTACACCTGTGGTTGGG + Intronic
954005842 3:47589916-47589938 CTAAGATTACAGATGTGGCTGGG + Intronic
954235885 3:49256890-49256912 TTGAATTTACAGGTCTGGATTGG - Exonic
954272963 3:49523832-49523854 CTGATTTTACAGATGACACTGGG + Intronic
955655055 3:61236603-61236625 CTCACTTTACAGATGTGGAAAGG + Intronic
955711612 3:61785141-61785163 CTTAATTCACAAACGTGGCTTGG - Intronic
955969987 3:64429226-64429248 CTTAATTTAAAAATATGGCTGGG - Intronic
957136382 3:76294235-76294257 CTGGATCTGCAGCTGTGGCTGGG + Intronic
957173173 3:76766061-76766083 GTGAATTTAGAAATGTGACTAGG - Intronic
958687081 3:97412338-97412360 CTGAATTTAAAGGTGTAACTTGG - Intronic
959946768 3:112133418-112133440 CTGAAATTACAGATGGGCCATGG + Intergenic
963961618 3:151315357-151315379 CTGCATTCAGAGATGTGGGTGGG - Intronic
964143593 3:153432080-153432102 CCTACTTTACAGATGTGTCTGGG + Intergenic
964764779 3:160169393-160169415 CTGCATTTAGAGAAGAGGCTGGG - Intergenic
965734153 3:171803274-171803296 CTGAATTTGGGGATGTGGTTGGG - Intronic
967372681 3:188765581-188765603 CTCATTTTACAAATGTGGCTCGG + Intronic
969290210 4:6234083-6234105 CTTATTTTACAGATGAGGCCGGG - Intergenic
971404298 4:26307134-26307156 CTGTTTTTACAGATGTGCCTCGG - Intronic
971590665 4:28464904-28464926 TTTAATTTGCAGATGTGGTTTGG - Intergenic
972656935 4:41072903-41072925 CCCATTTTACAGATGAGGCTTGG - Intronic
972737047 4:41852769-41852791 CTTAACTTACAGCTGTGCCTCGG + Intergenic
975433323 4:74320813-74320835 CTGAAATGACAGATCTGGCAAGG - Intergenic
976035439 4:80813767-80813789 CTGTATTTACACATTTGGCAAGG - Intronic
976232069 4:82854856-82854878 CTGCATTTACATACGTGGCAGGG - Intronic
977624815 4:99179009-99179031 CAGACTTGACAGATGTGACTGGG + Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978378439 4:108100615-108100637 CTGAATTTACAGTAGTGTCCAGG + Intronic
981326610 4:143455673-143455695 CTGAATTTACAGATGTGGCTTGG - Intronic
981832459 4:149018049-149018071 ATGGATTTACTGAGGTGGCTGGG + Intergenic
982135620 4:152271802-152271824 CTTGATTTACAGATGCTGCTGGG + Intergenic
985480198 5:105250-105272 GTGGATTCACAGCTGTGGCTGGG + Intergenic
985836489 5:2275925-2275947 TTGAAACTCCAGATGTGGCTTGG - Intergenic
988271364 5:29021932-29021954 CTCAATTTACATTTGTGCCTCGG + Intergenic
988981590 5:36575116-36575138 CACAATTTAAAGATGTGGCAGGG + Intergenic
998248990 5:140536726-140536748 GTTAATTTTCAAATGTGGCTGGG + Intronic
998690706 5:144584461-144584483 CTGAAGTGACAGATGCTGCTGGG - Intergenic
999185446 5:149703933-149703955 CTTATTTTACAGATGTTGGTTGG + Intergenic
1000725454 5:164764187-164764209 CTGAACTTACAAATGTGGTTTGG + Intergenic
1001427723 5:171634929-171634951 CCGAATTTGCAGATGGGGGTTGG + Intergenic
1002073595 5:176695268-176695290 CTGAATTTAGTCATGTGGCAGGG + Intergenic
1005090978 6:22056892-22056914 TTGAGTTTCCAGGTGTGGCTGGG + Intergenic
1005673552 6:28131309-28131331 CTCAAATTAGAGATGTGGCCAGG - Intergenic
1006765710 6:36504133-36504155 TTGAATTTACAGAAGTGAGTAGG - Intronic
1013859883 6:114623100-114623122 CTAATTTTACAGATGAGGATGGG + Intergenic
1015305596 6:131703704-131703726 CTGAGTTTACTGATGGTGCTGGG + Intronic
1016474886 6:144416409-144416431 CTGATTCTCCAGATGTGCCTGGG + Intronic
1021343808 7:19497853-19497875 ATAATTTTACAGATGTGGGTGGG + Intergenic
1021553995 7:21901165-21901187 CTGAAGGTCCAGATGTAGCTGGG - Exonic
1022200809 7:28115194-28115216 TTAAAATTACATATGTGGCTTGG - Intronic
1023176754 7:37442995-37443017 CCCATTTTACAGATGTGGCTTGG - Intronic
1024925511 7:54609573-54609595 ATGAATTTATAAATGTAGCTTGG + Intergenic
1028154694 7:87416668-87416690 CAGAAGTTAGAGATTTGGCTGGG - Intronic
1028342721 7:89742169-89742191 CTGAACTTACCTTTGTGGCTGGG - Intergenic
1031050867 7:116944058-116944080 CCCAATTTACAGATGAGGTTGGG + Intergenic
1031127859 7:117794402-117794424 CTGATTATAAAGATGTGGATAGG + Intronic
1033739712 7:144261935-144261957 CTGAGTTTACTGATGGTGCTGGG + Intergenic
1035409407 7:158626977-158626999 CTAAATTTACAGATCAAGCTGGG - Intergenic
1035585762 8:772194-772216 TTAAAATTACAGATGAGGCTGGG - Intergenic
1035651761 8:1271541-1271563 TTGAATTTTCAGATGTTTCTCGG - Intergenic
1036474991 8:9085018-9085040 CTGAATTTATAGAAGTTTCTAGG - Intronic
1036650096 8:10636683-10636705 CTGGATTAGCAGCTGTGGCTTGG - Intronic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1038341534 8:26690226-26690248 CTGAACTTGCAGATGGGGGTAGG + Intergenic
1038865810 8:31437756-31437778 CTGAATTTACTGATCAGCCTTGG - Intergenic
1043043026 8:75286050-75286072 CTGAATATTCAGATGTGATTAGG + Intergenic
1044230144 8:89765345-89765367 CTGAATATCCTGATGTTGCTTGG + Exonic
1044512508 8:93098728-93098750 CTTATTTTAGAGATGTGCCTGGG + Intergenic
1046548289 8:115679823-115679845 ATAAAATCACAGATGTGGCTGGG + Intronic
1046889137 8:119401756-119401778 CTTAATTTACAGAGGTGACATGG - Intergenic
1048103613 8:131382747-131382769 TTGAATTCACAGATTTGTCTGGG + Intergenic
1050311603 9:4358932-4358954 CTGTAGTTCAAGATGTGGCTGGG + Intergenic
1050707924 9:8424957-8424979 ATGAATTTGCAGTTTTGGCTAGG - Intronic
1050871779 9:10580415-10580437 TTGAATTCACATATGTGCCTAGG - Intronic
1050947016 9:11536362-11536384 CTTAATTGCCAAATGTGGCTAGG - Intergenic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1051156938 9:14158505-14158527 CTTTATTTACAGAAGTGACTGGG + Intronic
1053206298 9:36189245-36189267 ATGATTTCACAGAGGTGGCTTGG - Intergenic
1057589756 9:96362210-96362232 CAGAATTTAGGGATGTGGCTGGG + Intronic
1057930613 9:99189966-99189988 CTGAATTTAAAGAAGTGATTTGG + Intergenic
1059437976 9:114287868-114287890 CCCAATTCACAGATGAGGCTCGG - Intronic
1190010286 X:46778821-46778843 ATGAATTTAGAAATGTGGCCAGG + Intergenic
1192988108 X:76422091-76422113 CTGATTTATCAGATGTGCCTTGG - Intergenic
1193530996 X:82654260-82654282 TTCAATTTACACATGGGGCTGGG - Intergenic
1195279189 X:103313526-103313548 CTGAATTTACAGATGAATTTGGG - Intergenic
1197334374 X:125194077-125194099 TGGAAATTACAGATCTGGCTGGG - Intergenic
1198012818 X:132576212-132576234 TTTAATTTAAAGAAGTGGCTGGG - Intergenic
1199532136 X:148861784-148861806 ATGTATTTTCAGATGTGGCGGGG - Intronic
1199538849 X:148934965-148934987 CTGAATATACATATATGGATGGG + Intronic
1200958231 Y:8972276-8972298 ATGGATTTGCAGATGAGGCTGGG - Intergenic