ID: 981331392

View in Genome Browser
Species Human (GRCh38)
Location 4:143513973-143513995
Sequence ATCGAGGCTGCGGGCTTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981331392_981331401 10 Left 981331392 4:143513973-143513995 CCTTCCAAGCCCGCAGCCTCGAT 0: 1
1: 0
2: 0
3: 9
4: 92
Right 981331401 4:143514006-143514028 GGGAGCAACAGCAGCAACAAAGG 0: 1
1: 0
2: 5
3: 30
4: 396
981331392_981331404 30 Left 981331392 4:143513973-143513995 CCTTCCAAGCCCGCAGCCTCGAT 0: 1
1: 0
2: 0
3: 9
4: 92
Right 981331404 4:143514026-143514048 AGGCGGCCCCGAAGGCGTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 69
981331392_981331398 -10 Left 981331392 4:143513973-143513995 CCTTCCAAGCCCGCAGCCTCGAT 0: 1
1: 0
2: 0
3: 9
4: 92
Right 981331398 4:143513986-143514008 CAGCCTCGATCGCCAGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 55
981331392_981331402 13 Left 981331392 4:143513973-143513995 CCTTCCAAGCCCGCAGCCTCGAT 0: 1
1: 0
2: 0
3: 9
4: 92
Right 981331402 4:143514009-143514031 AGCAACAGCAGCAACAAAGGCGG 0: 1
1: 0
2: 9
3: 88
4: 565
981331392_981331403 22 Left 981331392 4:143513973-143513995 CCTTCCAAGCCCGCAGCCTCGAT 0: 1
1: 0
2: 0
3: 9
4: 92
Right 981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981331392 Original CRISPR ATCGAGGCTGCGGGCTTGGA AGG (reversed) Exonic