ID: 981331393

View in Genome Browser
Species Human (GRCh38)
Location 4:143513977-143513999
Sequence GGCGATCGAGGCTGCGGGCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981331393_981331402 9 Left 981331393 4:143513977-143513999 CCAAGCCCGCAGCCTCGATCGCC 0: 1
1: 0
2: 2
3: 6
4: 122
Right 981331402 4:143514009-143514031 AGCAACAGCAGCAACAAAGGCGG 0: 1
1: 0
2: 9
3: 88
4: 565
981331393_981331403 18 Left 981331393 4:143513977-143513999 CCAAGCCCGCAGCCTCGATCGCC 0: 1
1: 0
2: 2
3: 6
4: 122
Right 981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 42
981331393_981331404 26 Left 981331393 4:143513977-143513999 CCAAGCCCGCAGCCTCGATCGCC 0: 1
1: 0
2: 2
3: 6
4: 122
Right 981331404 4:143514026-143514048 AGGCGGCCCCGAAGGCGTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 69
981331393_981331401 6 Left 981331393 4:143513977-143513999 CCAAGCCCGCAGCCTCGATCGCC 0: 1
1: 0
2: 2
3: 6
4: 122
Right 981331401 4:143514006-143514028 GGGAGCAACAGCAGCAACAAAGG 0: 1
1: 0
2: 5
3: 30
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981331393 Original CRISPR GGCGATCGAGGCTGCGGGCT TGG (reversed) Exonic