ID: 981331396

View in Genome Browser
Species Human (GRCh38)
Location 4:143513983-143514005
Sequence GCCGCTGGCGATCGAGGCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981331396_981331406 26 Left 981331396 4:143513983-143514005 CCGCAGCCTCGATCGCCAGCGGC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 981331406 4:143514032-143514054 CCCCGAAGGCGTCGCGGCGCAGG 0: 1
1: 0
2: 3
3: 7
4: 50
981331396_981331402 3 Left 981331396 4:143513983-143514005 CCGCAGCCTCGATCGCCAGCGGC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 981331402 4:143514009-143514031 AGCAACAGCAGCAACAAAGGCGG 0: 1
1: 0
2: 9
3: 88
4: 565
981331396_981331401 0 Left 981331396 4:143513983-143514005 CCGCAGCCTCGATCGCCAGCGGC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 981331401 4:143514006-143514028 GGGAGCAACAGCAGCAACAAAGG 0: 1
1: 0
2: 5
3: 30
4: 396
981331396_981331404 20 Left 981331396 4:143513983-143514005 CCGCAGCCTCGATCGCCAGCGGC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 981331404 4:143514026-143514048 AGGCGGCCCCGAAGGCGTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 69
981331396_981331403 12 Left 981331396 4:143513983-143514005 CCGCAGCCTCGATCGCCAGCGGC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 42
981331396_981331409 29 Left 981331396 4:143513983-143514005 CCGCAGCCTCGATCGCCAGCGGC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 981331409 4:143514035-143514057 CGAAGGCGTCGCGGCGCAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981331396 Original CRISPR GCCGCTGGCGATCGAGGCTG CGG (reversed) Exonic