ID: 981331400

View in Genome Browser
Species Human (GRCh38)
Location 4:143513998-143514020
Sequence GCTGCTGTTGCTCCCGCCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 7, 3: 40, 4: 378}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981331400_981331409 14 Left 981331400 4:143513998-143514020 CCAGCGGCGGGAGCAACAGCAGC 0: 1
1: 0
2: 7
3: 40
4: 378
Right 981331409 4:143514035-143514057 CGAAGGCGTCGCGGCGCAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 75
981331400_981331406 11 Left 981331400 4:143513998-143514020 CCAGCGGCGGGAGCAACAGCAGC 0: 1
1: 0
2: 7
3: 40
4: 378
Right 981331406 4:143514032-143514054 CCCCGAAGGCGTCGCGGCGCAGG 0: 1
1: 0
2: 3
3: 7
4: 50
981331400_981331410 26 Left 981331400 4:143513998-143514020 CCAGCGGCGGGAGCAACAGCAGC 0: 1
1: 0
2: 7
3: 40
4: 378
Right 981331410 4:143514047-143514069 GGCGCAGGCGGTTGCGTCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 117
981331400_981331404 5 Left 981331400 4:143513998-143514020 CCAGCGGCGGGAGCAACAGCAGC 0: 1
1: 0
2: 7
3: 40
4: 378
Right 981331404 4:143514026-143514048 AGGCGGCCCCGAAGGCGTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 69
981331400_981331403 -3 Left 981331400 4:143513998-143514020 CCAGCGGCGGGAGCAACAGCAGC 0: 1
1: 0
2: 7
3: 40
4: 378
Right 981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981331400 Original CRISPR GCTGCTGTTGCTCCCGCCGC TGG (reversed) Exonic