ID: 981331403

View in Genome Browser
Species Human (GRCh38)
Location 4:143514018-143514040
Sequence AGCAACAAAGGCGGCCCCGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 42}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981331400_981331403 -3 Left 981331400 4:143513998-143514020 CCAGCGGCGGGAGCAACAGCAGC 0: 1
1: 0
2: 7
3: 40
4: 378
Right 981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 42
981331394_981331403 13 Left 981331394 4:143513982-143514004 CCCGCAGCCTCGATCGCCAGCGG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 42
981331393_981331403 18 Left 981331393 4:143513977-143513999 CCAAGCCCGCAGCCTCGATCGCC 0: 1
1: 0
2: 2
3: 6
4: 122
Right 981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 42
981331392_981331403 22 Left 981331392 4:143513973-143513995 CCTTCCAAGCCCGCAGCCTCGAT 0: 1
1: 0
2: 0
3: 9
4: 92
Right 981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 42
981331399_981331403 6 Left 981331399 4:143513989-143514011 CCTCGATCGCCAGCGGCGGGAGC 0: 1
1: 0
2: 0
3: 5
4: 73
Right 981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 42
981331396_981331403 12 Left 981331396 4:143513983-143514005 CCGCAGCCTCGATCGCCAGCGGC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981331403 Original CRISPR AGCAACAAAGGCGGCCCCGA AGG Exonic
904110363 1:28121432-28121454 AGCAACACGGGCGGACCCCAGGG + Intergenic
905880060 1:41457480-41457502 AGCAGCAGGGGCAGCCCCGAGGG + Intergenic
910527454 1:88197345-88197367 AGCAACTAATGCAGCCCAGAGGG + Intergenic
915265817 1:154716838-154716860 GGCAAAAAAGGCGGCACGGAAGG + Intronic
916651695 1:166839702-166839724 CGCAACAAAGGCGGCGGCGGCGG - Intronic
916811150 1:168306906-168306928 AGGAGCAAAGGCTGCCCAGAGGG + Intronic
920223338 1:204420494-204420516 AGAAACAAAGGCAGCCCAGGGGG - Intergenic
1063867063 10:10376683-10376705 AGAAACAAAGGTGGCTCCCAAGG + Intergenic
1069832551 10:71290024-71290046 AGCAAAAATGGCGGCCAAGATGG - Intronic
1076302936 10:129441740-129441762 AGCTTCAAAGGCGGCCCCCAGGG + Intergenic
1084191311 11:67500193-67500215 AGCAACACTGGCACCCCCGATGG - Exonic
1090636934 11:128695087-128695109 TGCAACGGAGGCGGCTCCGAAGG - Intronic
1104708504 12:130967689-130967711 AGCAACAGAGGCAGCACCGATGG - Intronic
1104849243 12:131863379-131863401 AGCAACAAAGCCGCCCCCGCAGG - Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1111197475 13:84894142-84894164 AGTCATAAAGGCGGCGCCGATGG + Intergenic
1113572843 13:111370897-111370919 GGAAACAAAGGTGGCCCAGATGG - Intergenic
1113646054 13:111996799-111996821 AGCCACCAAGGCAGCCCCGGAGG + Intergenic
1123210919 14:106760117-106760139 AGTAACAAAGGCACCCACGAGGG - Intergenic
1134254913 16:12602903-12602925 AGCAACGCAAGCAGCCCCGACGG + Intergenic
1151608310 17:75154181-75154203 CGGCACAAAGGCGGCGCCGACGG + Intronic
1158046900 18:53167139-53167161 AGCAACAAATGCTGCCTTGAGGG - Intronic
1161521922 19:4729480-4729502 AGCAAGAAAGGGGGCACTGAGGG - Intergenic
1162797036 19:13092388-13092410 AGGGACAAAGGCTGCCCCAAGGG - Intronic
1165371826 19:35413002-35413024 AGTAACAAAGCCGGCTCAGATGG + Intergenic
925003778 2:426536-426558 AGGCACAAAGGGGGCTCCGATGG + Intergenic
937710855 2:124978494-124978516 AGCAGCAAAGGTGGCCTGGATGG - Intergenic
944440654 2:199740244-199740266 AGAAACAAAGGCAGCCACGGTGG + Intergenic
948999212 2:241602792-241602814 AGCTACACAGTCGGCCCCGCAGG + Intronic
1168890750 20:1294191-1294213 AGTAACAAAGCCGGCCTTGAAGG + Intronic
1171159682 20:22909904-22909926 AGCAACAAAGGAGGCCTAAAGGG + Intergenic
1171382668 20:24745386-24745408 AGAAACAAAGGTGGCCACGCTGG - Intergenic
1182714126 22:32341329-32341351 AGCAAGAAGGGCGGCCGTGAGGG + Intergenic
1183733736 22:39632126-39632148 AGCGACAAAGGCCGGCCCGAGGG + Intronic
955593524 3:60563159-60563181 AGCTACAAAGGCGAGCCCGATGG + Intronic
968702100 4:2062093-2062115 AGCAACACAGGGGGCTCCGGTGG + Intronic
969115661 4:4869274-4869296 TGCAACAAAGGCTGCCACGTAGG - Intergenic
971018936 4:22515632-22515654 AGCACGATGGGCGGCCCCGAGGG - Exonic
977477977 4:97537426-97537448 AGCAACAAGGGAGGCTCTGAGGG - Intronic
981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG + Exonic
992164042 5:74031092-74031114 ACCAACAAAAGCAGCCCCGGTGG - Intergenic
1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG + Exonic
1003868349 6:10382872-10382894 AGCAAGAAAGGGGGCGCCGGGGG + Intergenic
1007607139 6:43125267-43125289 AACATCAAAGCTGGCCCCGAGGG - Intronic
1011139988 6:84142066-84142088 AGAAAAAAAGGCAGCCCAGAGGG + Intronic
1022095968 7:27142064-27142086 GACAACATAGGCGGCCCGGAAGG - Exonic
1033121009 7:138666455-138666477 AGCAACTAAGACGGGCCCCAAGG + Intronic
1048055475 8:130858840-130858862 ACCAACAAAAGAGCCCCCGAGGG - Intronic
1053270514 9:36746320-36746342 ACAACCAAAGGCAGCCCCGAGGG + Intergenic