ID: 981331403

View in Genome Browser
Species Human (GRCh38)
Location 4:143514018-143514040
Sequence AGCAACAAAGGCGGCCCCGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 42}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981331400_981331403 -3 Left 981331400 4:143513998-143514020 CCAGCGGCGGGAGCAACAGCAGC 0: 1
1: 0
2: 7
3: 40
4: 378
Right 981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 42
981331396_981331403 12 Left 981331396 4:143513983-143514005 CCGCAGCCTCGATCGCCAGCGGC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 42
981331392_981331403 22 Left 981331392 4:143513973-143513995 CCTTCCAAGCCCGCAGCCTCGAT 0: 1
1: 0
2: 0
3: 9
4: 92
Right 981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 42
981331399_981331403 6 Left 981331399 4:143513989-143514011 CCTCGATCGCCAGCGGCGGGAGC 0: 1
1: 0
2: 0
3: 5
4: 73
Right 981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 42
981331393_981331403 18 Left 981331393 4:143513977-143513999 CCAAGCCCGCAGCCTCGATCGCC 0: 1
1: 0
2: 2
3: 6
4: 122
Right 981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 42
981331394_981331403 13 Left 981331394 4:143513982-143514004 CCCGCAGCCTCGATCGCCAGCGG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG 0: 1
1: 0
2: 0
3: 6
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981331403 Original CRISPR AGCAACAAAGGCGGCCCCGA AGG Exonic