ID: 981332224

View in Genome Browser
Species Human (GRCh38)
Location 4:143524569-143524591
Sequence TAGTAGTCTTAGATGTTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 456}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981332222_981332224 30 Left 981332222 4:143524516-143524538 CCTTTGGTTAATGTTTTGGATTT 0: 1
1: 0
2: 2
3: 46
4: 735
Right 981332224 4:143524569-143524591 TAGTAGTCTTAGATGTTTATTGG 0: 1
1: 0
2: 3
3: 30
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981332224 Original CRISPR TAGTAGTCTTAGATGTTTAT TGG Intronic
904018395 1:27442209-27442231 TAGTAGTTGTATATGTTTATGGG - Intronic
904584322 1:31571307-31571329 TAGTTTTCTAAGATGTTTGTGGG + Intergenic
904850177 1:33453392-33453414 TAGTAGGCGTATATATTTATGGG - Intergenic
906757622 1:48333972-48333994 TAGTAATCTCTGATGGTTATTGG - Intronic
907536548 1:55166026-55166048 TAGTAGGTGTATATGTTTATGGG + Intronic
908353789 1:63312048-63312070 TAGTAGTTGTATATATTTATGGG + Intergenic
908611235 1:65863985-65864007 TATTAATCTTAAATGTATATAGG - Intronic
909627542 1:77734656-77734678 ACGTAGTCTTAAATGTTAATAGG - Intronic
910136503 1:83978064-83978086 TAGTAGACATATATATTTATGGG + Intronic
910472517 1:87570597-87570619 TAGCATTCTTAGATATTTATAGG - Intergenic
911096407 1:94058697-94058719 TAGAAGTCCTAAAAGTTTATGGG - Intronic
911132962 1:94409330-94409352 TAGTAGGTGTATATGTTTATGGG - Intergenic
911524577 1:98968685-98968707 TAGTAGATTTATATATTTATGGG - Intronic
911925343 1:103823051-103823073 TAGTAGTTATATATATTTATGGG - Intergenic
912100427 1:106196981-106197003 TAGTAGTTGTATATATTTATGGG - Intergenic
912122049 1:106483406-106483428 TAATAGTTTTACATGTTTATGGG - Intergenic
912857588 1:113184494-113184516 TAGTAGGCATATATATTTATGGG - Intergenic
912879341 1:113392257-113392279 CTGTCGTCTTAGATGTTTGTGGG + Intronic
914931834 1:151941893-151941915 TACTATTTTTAGATATTTATGGG + Intergenic
914996902 1:152551782-152551804 TATTAATCTTAAATGTATATGGG - Intronic
915754346 1:158244593-158244615 TAGTAGGTATACATGTTTATGGG - Intergenic
915781596 1:158557846-158557868 TAGTAGTTGTATATATTTATGGG - Intergenic
916341236 1:163738102-163738124 TAGTAGGCATATATATTTATGGG + Intergenic
916857643 1:168767162-168767184 TAGTAGGCATATATATTTATGGG - Intergenic
917438144 1:175041708-175041730 TAGTAGGCATATATATTTATAGG + Intergenic
918620371 1:186597099-186597121 TAATAGTTCTACATGTTTATTGG + Intergenic
918747466 1:188223284-188223306 TAGTAGTTGTATATGTTTATGGG + Intergenic
919512160 1:198478670-198478692 TAGTAGTCATACATATTTAAGGG - Intergenic
920330133 1:205201346-205201368 TAGTAGGTTTATATATTTATGGG - Intronic
920587265 1:207178582-207178604 TAGTAGTTGTATATATTTATGGG + Intergenic
920689753 1:208136842-208136864 TAGTAGTCTTAGAACTTCTTTGG - Intronic
921505914 1:215969855-215969877 CATTAGTCTTAGATATTTTTTGG - Intronic
921518500 1:216128625-216128647 TAATAGTTGTAGATATTTATGGG + Intronic
921775469 1:219094721-219094743 TAGTAGGTATATATGTTTATGGG - Intergenic
921994539 1:221403827-221403849 TAGTAGTTGTATATATTTATGGG - Intergenic
922050913 1:221989842-221989864 TAGTAGTGATATATGTATATAGG + Intergenic
922086979 1:222358963-222358985 TTGTAGGCATATATGTTTATGGG - Intergenic
923067195 1:230528909-230528931 TATTAATCTTAAATGTATATGGG + Intergenic
923178439 1:231492425-231492447 TAGTAGGCCTATATATTTATTGG + Intergenic
924499045 1:244619111-244619133 TAGAATTCTTAACTGTTTATAGG - Intronic
1064808584 10:19166685-19166707 TAGTAGTTGTACATATTTATGGG - Intronic
1066059883 10:31713471-31713493 TAGTAGTTGTATATATTTATGGG + Intergenic
1066538280 10:36415225-36415247 TAGTAGGCATATATATTTATGGG + Intergenic
1067016723 10:42761842-42761864 TAGTAGGCATATATATTTATGGG + Intergenic
1067199672 10:44156515-44156537 TAGTAGGTTTATATATTTATGGG + Intergenic
1068488552 10:57692297-57692319 TAATAGTCATACATATTTATGGG - Intergenic
1068542455 10:58310609-58310631 TAGTAGTTGTATATATTTATGGG - Intergenic
1068542715 10:58313259-58313281 TAGTAGTTGTATATATTTATGGG - Intergenic
1068709833 10:60121901-60121923 TAGTAGGCATATATATTTATGGG - Intronic
1069055611 10:63841416-63841438 TCATAGTCTTGGATGGTTATAGG - Intergenic
1069152444 10:64981155-64981177 TGGTAGCCTCAGATGTTTCTTGG - Intergenic
1069241821 10:66150519-66150541 TAATAGTCATACATATTTATGGG + Intronic
1069803868 10:71105008-71105030 TAGTACTGTAAGATGTTAATAGG + Intergenic
1071007807 10:80902784-80902806 TAGTAGACGTATATATTTATGGG + Intergenic
1071122567 10:82296538-82296560 TAGTATTTGTACATGTTTATGGG + Intronic
1071535453 10:86425400-86425422 TATTAGTTTTACATATTTATGGG - Intergenic
1072042194 10:91618450-91618472 TACTAATCTTATATGTTTATAGG + Intergenic
1072381902 10:94881215-94881237 TAGTAGATATACATGTTTATGGG + Intergenic
1073174636 10:101546442-101546464 TAGTAGGTTTATATATTTATGGG + Intronic
1074013914 10:109513187-109513209 TAGTAGTCTCTGATGGGTATAGG + Intergenic
1074484233 10:113856874-113856896 TAGAAGACTTACATGTTTATAGG + Intronic
1074623948 10:115157279-115157301 TATTAGTATTAGCTGTTTAATGG + Intronic
1074913498 10:117934192-117934214 TAGTAATTGTATATGTTTATGGG - Intergenic
1075148314 10:119902502-119902524 TAGTAGGTATATATGTTTATGGG + Intronic
1077757578 11:5050379-5050401 TAGTAGGTGTATATGTTTATGGG - Intergenic
1078243576 11:9552459-9552481 TAGTAGGTATATATGTTTATGGG + Intergenic
1078332062 11:10430722-10430744 TAGTAGGTGTATATGTTTATGGG + Intronic
1079622945 11:22576931-22576953 TAGTAGGTGTATATGTTTATGGG - Intergenic
1079786666 11:24681593-24681615 TTGTAGTCTTAAATGTATTTTGG + Intronic
1081469091 11:43353087-43353109 TAGTCATCTTAGGTTTTTATTGG - Intergenic
1082195163 11:49295655-49295677 CAGTAGGCGTATATGTTTATGGG + Intergenic
1083500433 11:63102204-63102226 TAGTAGTTATAAATATTTATGGG - Intronic
1085075255 11:73585510-73585532 TAGTAGTCTAAGAAATTTAATGG - Intronic
1085526007 11:77164367-77164389 TAGTAGGTATAGATATTTATGGG - Intronic
1085863771 11:80263602-80263624 TAATAGTTGTACATGTTTATGGG + Intergenic
1086032706 11:82379422-82379444 TAGTAGTTGTATATATTTATGGG + Intergenic
1086660772 11:89413884-89413906 TAGTAGGCATATATGTTTATGGG - Intronic
1087068504 11:94050543-94050565 TAGTAGATGTATATGTTTATGGG + Intronic
1087337651 11:96864755-96864777 TAGTAGATTTATATATTTATAGG + Intergenic
1087874163 11:103336169-103336191 TAGTAGTTGTACATATTTATAGG + Intronic
1088072622 11:105809237-105809259 TAATAGTTTTACATATTTATGGG + Intronic
1088144977 11:106665532-106665554 TAATAATCGTACATGTTTATGGG + Intergenic
1088256723 11:107910136-107910158 TAGTAGGACTATATGTTTATAGG + Intronic
1090064998 11:123495303-123495325 TAGTAGGTGTATATGTTTATGGG + Intergenic
1090111703 11:123917673-123917695 TAGTAGGCATATATATTTATGGG - Intergenic
1090693583 11:129212816-129212838 TAATAGTTGTACATGTTTATGGG - Intronic
1092013710 12:5138993-5139015 TGGTAGTCATAGCTGCTTATAGG - Intergenic
1093069967 12:14698526-14698548 TAGTAGTTGTATATTTTTATGGG + Intergenic
1093298203 12:17417423-17417445 TAATAATTATAGATGTTTATGGG + Intergenic
1093797660 12:23332594-23332616 TAGTAGGTGTATATGTTTATAGG + Intergenic
1094345127 12:29459739-29459761 TAGTAGGCATATATATTTATGGG - Intronic
1094482134 12:30893018-30893040 TATTAATCTTAAATGTATATGGG - Intergenic
1095228757 12:39708271-39708293 TAGTAGGCATATATATTTATGGG - Intronic
1096539667 12:52298833-52298855 TAATAGTTATACATGTTTATGGG + Intronic
1097431318 12:59511335-59511357 TAGTAGTTGTACATATTTATGGG - Intergenic
1098642055 12:72850992-72851014 CAGTAGTTTCAGTTGTTTATAGG - Intergenic
1099040795 12:77652090-77652112 TAGTAGTATTACAATTTTATAGG - Intergenic
1099271580 12:80517386-80517408 TAGTAGGTTTATATATTTATGGG + Intronic
1099944415 12:89227529-89227551 TAGTAGGTATATATGTTTATGGG - Intergenic
1100722141 12:97370456-97370478 TAGTAGGTGTATATGTTTATAGG - Intergenic
1101178563 12:102184209-102184231 TAGTAGGTGTATATGTTTATGGG + Intronic
1101410362 12:104462739-104462761 TAGTAGTTGTATATATTTATGGG - Intronic
1101608209 12:106266438-106266460 TAGTAGGCATATATATTTATGGG - Intronic
1101938913 12:109084336-109084358 TAGCATTCATACATGTTTATGGG - Intronic
1103290992 12:119846130-119846152 TAGTTTTCTTACATGTTGATGGG - Intronic
1104097147 12:125568269-125568291 TAGTAGGCATATATATTTATGGG + Intronic
1105321598 13:19328535-19328557 TAGTAGATATATATGTTTATGGG - Intergenic
1105956032 13:25283626-25283648 TAGTAGGATCAGATTTTTATGGG + Intronic
1106541574 13:30695387-30695409 TGGTAGGATTACATGTTTATTGG - Intergenic
1107861178 13:44662257-44662279 TGGTAATCTTTGATGTTTCTCGG - Intergenic
1108773692 13:53736396-53736418 TAGTAGTTATATATATTTATGGG - Intergenic
1108931012 13:55819868-55819890 TAGTAGGTATATATGTTTATGGG + Intergenic
1109212947 13:59555872-59555894 TAATAATTATAGATGTTTATGGG - Intergenic
1110407056 13:75162561-75162583 TAGTAGACATACATATTTATGGG - Intergenic
1110472078 13:75871621-75871643 TAATAGTTGTACATGTTTATGGG + Intronic
1110476199 13:75916814-75916836 TAGGAGTCTAAGATGTTGATAGG - Intergenic
1111290396 13:86160642-86160664 TAGTAATTGTACATGTTTATGGG - Intergenic
1111713411 13:91846799-91846821 TAATAGTTTTCAATGTTTATGGG + Intronic
1111759688 13:92445974-92445996 TAGTAGGTATATATGTTTATTGG + Intronic
1112831872 13:103462779-103462801 TAATAATCGTACATGTTTATGGG + Intergenic
1113418305 13:110149136-110149158 TAGTAGTCTTAGAAATGTTTTGG + Exonic
1113470913 13:110545303-110545325 TAGTAGGCGTATATATTTATGGG - Intronic
1114592572 14:23880702-23880724 TAATAGTTTTACATATTTATGGG - Intergenic
1114718557 14:24854805-24854827 TATTAGACATAGATGTTTAAAGG - Intronic
1115708523 14:36024449-36024471 TAGTAGGCATATATATTTATAGG + Intergenic
1115791494 14:36883850-36883872 TAATAATTTTATATGTTTATGGG + Intronic
1116021124 14:39462370-39462392 TAGTAGTTATATATATTTATAGG + Intergenic
1116026040 14:39516579-39516601 TAGTAGATATAAATGTTTATAGG - Intergenic
1116157465 14:41225173-41225195 AAGTATTTTTATATGTTTATTGG - Intergenic
1116290081 14:43023343-43023365 TACTATTCATACATGTTTATGGG - Intergenic
1116360508 14:43990062-43990084 TAGTAGTCCTAGAGCTTTCTGGG - Intergenic
1116393978 14:44426251-44426273 TAGTAGGTGTACATGTTTATTGG - Intergenic
1116571246 14:46518528-46518550 TAGTAGTTTTACATATTTATGGG - Intergenic
1116591171 14:46775468-46775490 TATTAATCTTAGATATTTAAAGG - Intergenic
1116650847 14:47590759-47590781 TAGTAGGCTTGTATATTTATGGG - Intronic
1116675065 14:47895777-47895799 TAGTATTGTTAGACATTTATAGG - Intergenic
1116850064 14:49900010-49900032 TAGTAGTCTAAAATAGTTATAGG - Intergenic
1117251290 14:53941879-53941901 TAGTAGACATATATATTTATGGG + Intergenic
1117446861 14:55811995-55812017 TATTAGCCTTAGATGTAAATGGG + Intergenic
1117960368 14:61156108-61156130 TAGTAGTTGTATATATTTATGGG - Intergenic
1118916316 14:70110072-70110094 TAGTAGTTGTATATATTTATTGG + Intronic
1119188018 14:72658261-72658283 TAGTAGATGTAGATATTTATGGG - Intronic
1120451021 14:84666900-84666922 TAGTAATCATACATATTTATAGG + Intergenic
1121087891 14:91160474-91160496 TAGAAGTCTTAGGAGTTTGTGGG - Intronic
1126464117 15:48944966-48944988 TAGTATTTTTAGATGTTTTTGGG - Intronic
1126653394 15:50949909-50949931 TAGTAGTCTCAGAAAGTTATTGG - Exonic
1126927708 15:53609111-53609133 TAGTGGTCATATATATTTATGGG - Intronic
1127858954 15:62977110-62977132 TAGTAGGTGTATATGTTTATGGG - Intergenic
1128966576 15:72064426-72064448 TAGTAGTTGTATATATTTATGGG - Intronic
1129315214 15:74738799-74738821 TAGTAGGTGTATATGTTTATGGG - Intergenic
1129593896 15:76943951-76943973 TAGTAGGTATATATGTTTATGGG + Intronic
1130237969 15:82155836-82155858 GAATAGTCTTTCATGTTTATTGG + Intronic
1130754677 15:86750290-86750312 TAGTAATTTTACATATTTATGGG + Intronic
1130962530 15:88672292-88672314 TAGTAGGCATATATTTTTATGGG - Intergenic
1131193377 15:90335271-90335293 TAGTAGGTTTATATATTTATGGG - Intergenic
1131947507 15:97642592-97642614 TAGTAGGTATAAATGTTTATGGG - Intergenic
1132366249 15:101259200-101259222 TAATAGTCATATATATTTATGGG + Intergenic
1135238854 16:20784819-20784841 TAGTAGTTGTATATGTTTATGGG + Intronic
1136388558 16:29946564-29946586 TAGTAGGCATATATATTTATAGG + Intronic
1137260577 16:46825460-46825482 TAGTAGGTGTACATGTTTATGGG + Intronic
1137946750 16:52740225-52740247 TAGTAGGTGTATATGTTTATAGG - Intergenic
1140764188 16:78140542-78140564 TGGTAGCCCTAGATGTTCATTGG + Intronic
1141723796 16:85772617-85772639 TAGAAGACCTAGTTGTTTATTGG - Intronic
1142630033 17:1219573-1219595 TATTAGTCTGAGATTTTAATGGG - Intronic
1145746148 17:27321393-27321415 TAGTAGGTGTATATGTTTATGGG + Intergenic
1146040149 17:29445143-29445165 TAGTAGGTTTATATATTTATGGG + Intronic
1146113008 17:30108592-30108614 TAGTAGTTGTACATATTTATGGG + Intergenic
1146743068 17:35303304-35303326 TATTAATCTTAAATGTATATGGG + Intergenic
1146750241 17:35372745-35372767 TAGTAGATGTATATGTTTATGGG - Intronic
1146778041 17:35639786-35639808 TAGTAGTTTTAGATGTCTTTGGG + Intronic
1150911930 17:69396984-69397006 TAGTAATAGTACATGTTTATGGG + Intergenic
1153074787 18:1149423-1149445 TAGTAGTCATACATGTTTATGGG + Intergenic
1153369730 18:4301009-4301031 TTATAGTTGTAGATGTTTATGGG + Intronic
1153662803 18:7340479-7340501 TAGTAGTTGTATATATTTATGGG - Intergenic
1154134657 18:11765296-11765318 TAATAGTTGTACATGTTTATAGG + Intronic
1154284850 18:13043882-13043904 TAGTAGTTGTATATATTTATGGG + Intronic
1155727188 18:29101946-29101968 TATTAGTTTTATATGTTTAGTGG + Intergenic
1156003918 18:32417980-32418002 TAGTAGGTGTATATGTTTATAGG - Intronic
1156043267 18:32848154-32848176 TAGGAGTCTGAGGTGTTTTTGGG + Intergenic
1156347681 18:36272854-36272876 TAGTAGGTTTATATATTTATTGG + Intergenic
1156556096 18:38069804-38069826 TAGTAGTTGTATATATTTATGGG - Intergenic
1157902511 18:51533335-51533357 GTGTATTCTTACATGTTTATTGG + Intergenic
1157977229 18:52340793-52340815 GAATAGTCTTAGATGTGTTTGGG + Exonic
1158159468 18:54464407-54464429 TAGTAGTGGTACATATTTATGGG + Intergenic
1158225166 18:55193362-55193384 TAGTAGGCTGTGATGTGTATGGG - Intergenic
1159388289 18:67755845-67755867 TAGTAGATGTATATGTTTATGGG - Intergenic
1159856292 18:73593457-73593479 TAATAATCTTACATGTTGATTGG - Intergenic
1159868580 18:73735007-73735029 TAGTAGTTGTATATATTTATTGG - Intergenic
1159931637 18:74318382-74318404 TACTAATCTAAGATGTTTATAGG - Intronic
1164491526 19:28719506-28719528 TAGTAGGTTTATATATTTATGGG - Intergenic
1164570302 19:29369816-29369838 TAATAGTTTCACATGTTTATGGG - Intergenic
1164994627 19:32711102-32711124 TACCAGTCACAGATGTTTATGGG + Intronic
1165684819 19:37810405-37810427 TAGTAGGCTAAGATTCTTATTGG - Intronic
1166416507 19:42598629-42598651 GAGTATTTTTATATGTTTATTGG + Intronic
1167805094 19:51777183-51777205 TAGTAGTTGTATATATTTATGGG - Intronic
1168386426 19:55966951-55966973 TAGTAGGCATATATATTTATGGG + Intronic
1168437680 19:56334486-56334508 TAGTAGGTGTATATGTTTATGGG + Intronic
925329482 2:3047335-3047357 TAGTAGGTGTATATGTTTATGGG - Intergenic
926565086 2:14459922-14459944 TAGTTGTCTTTGCTGTTCATTGG + Intergenic
927147475 2:20175992-20176014 TAGTAATTGTACATGTTTATGGG - Intergenic
927835991 2:26399709-26399731 TAATAGTTATATATGTTTATGGG + Intergenic
928448700 2:31357823-31357845 TAGTAGTTGTATATATTTATAGG - Intronic
930539491 2:52687424-52687446 TAGTATTTGTAGATGTTAATGGG - Intergenic
930894714 2:56432135-56432157 TAGTAGGCATATATATTTATGGG + Intergenic
931968611 2:67561332-67561354 TAGGGGTTTTATATGTTTATAGG - Intergenic
932629620 2:73328120-73328142 TAGTAATCATACATATTTATGGG + Intergenic
932645625 2:73498294-73498316 TAGTAGGTGTATATGTTTATGGG + Intronic
932871339 2:75402000-75402022 TAATAGTTTTACATGCTTATGGG + Intergenic
932970082 2:76530187-76530209 AAGTAGTCTTATTTGTATATGGG + Intergenic
933343662 2:81054498-81054520 TAGTAATTTTATATATTTATGGG + Intergenic
935629358 2:105200111-105200133 TAGTAGGCATATATATTTATGGG - Intergenic
936606458 2:113961802-113961824 TGGTAGTGTTAGTTGTTTAGAGG + Exonic
937177078 2:119949390-119949412 TAATAGTTGTACATGTTTATGGG + Intronic
937558060 2:123184236-123184258 TAATAGTTGTTGATGTTTATAGG - Intergenic
937673661 2:124565449-124565471 TAGTAGGTGTATATGTTTATGGG - Intronic
937922616 2:127141974-127141996 TAATAGCCATACATGTTTATGGG + Intergenic
938695409 2:133830746-133830768 TAGTAGGCATACATATTTATGGG - Intergenic
939184947 2:138849498-138849520 TAATAGTCGTATATATTTATGGG - Intergenic
940325719 2:152423062-152423084 TAGTAGGCATATATATTTATGGG + Intronic
940581012 2:155580931-155580953 TAGTAGGTATATATGTTTATGGG + Intergenic
942118714 2:172755232-172755254 GATTAATGTTAGATGTTTATGGG - Intronic
942352728 2:175069814-175069836 TAGTAGGCATATATATTTATGGG - Intergenic
942524161 2:176835452-176835474 TGGTAGGTTTATATGTTTATGGG - Intergenic
943086169 2:183314064-183314086 TAGTAGTTGTATATATTTATTGG + Intergenic
943281253 2:185936203-185936225 TAATATTCTTACATATTTATAGG + Intergenic
943328197 2:186526582-186526604 TAGTCGTCTTTGGTGTTTATAGG + Intergenic
943385077 2:187193105-187193127 TACTAGTTTTACATATTTATGGG - Intergenic
943794520 2:191975601-191975623 TAGTAGTTTTATTTTTTTATTGG + Intronic
943913703 2:193601242-193601264 TAGTAGTTGTATATATTTATGGG - Intergenic
944403008 2:199350080-199350102 TATTAGTTTTAAATGCTTATAGG + Intronic
944462918 2:199970507-199970529 TAGTAGGGTTATATATTTATGGG + Intronic
944507452 2:200427314-200427336 TAGTAGGTTTATATATTTATGGG - Intronic
944773513 2:202937958-202937980 TAGTAGTTGTAGATATTTATGGG + Intronic
945838864 2:214865080-214865102 TAGTAGGTATATATGTTTATGGG - Intergenic
946088886 2:217202557-217202579 TAGTAGGCATATATATTTATGGG - Intergenic
946121201 2:217516315-217516337 TAATAGTCATATATATTTATGGG + Intronic
946668473 2:222076387-222076409 TGGCAGTCTTAGGTGTTTCTTGG - Intergenic
947005654 2:225508504-225508526 TAGAAGTCTGGGAGGTTTATTGG + Intronic
947033740 2:225826952-225826974 TTGTATTCTTTGATCTTTATTGG - Intergenic
1168868659 20:1110221-1110243 TAGCAGTGTTAGAGGTTTATTGG - Intergenic
1169512025 20:6274804-6274826 TAGTGATCTTTGGTGTTTATTGG + Intergenic
1169679200 20:8191165-8191187 TAGTAGGTTTATATATTTATGGG + Intronic
1172244973 20:33439652-33439674 TAGTAGGCATATATATTTATGGG - Intronic
1172761321 20:37325037-37325059 TAGTAGGTGTATATGTTTATGGG + Intergenic
1174828921 20:53795107-53795129 TAGTAGGTGTATATGTTTATAGG + Intergenic
1175631616 20:60543606-60543628 TAGTAGATGTATATGTTTATGGG + Intergenic
1177024263 21:15902727-15902749 TAGTAGGTGTATATGTTTATGGG - Intergenic
1177244208 21:18501785-18501807 TAATTATCTTAGATGTGTATGGG + Intergenic
1177295427 21:19167373-19167395 TAGTAGGTGTAGATATTTATAGG - Intergenic
1177453701 21:21306573-21306595 TAGTAGGCATATATATTTATGGG + Intronic
1177547226 21:22574914-22574936 TAGTAGGTGTATATGTTTATGGG + Intergenic
1177622510 21:23614734-23614756 TAGTAGGCTTATATGTTTATGGG + Intergenic
1177658271 21:24047979-24048001 TATTATTCTTGTATGTTTATTGG + Intergenic
1177782495 21:25635890-25635912 TAATAGTTTTATATATTTATGGG - Intergenic
1178453360 21:32725688-32725710 TAGTAGTTTAAGATATTTAAGGG + Intronic
1179252420 21:39683181-39683203 TAGTAGGCATATATATTTATCGG + Intergenic
1181411404 22:22723144-22723166 TAGTAGGCATATATTTTTATTGG + Intergenic
1181882900 22:25995508-25995530 TAGTAGGCATATATATTTATGGG - Intronic
1182213641 22:28698033-28698055 TAGTAGGTGTACATGTTTATGGG - Intronic
950711666 3:14817594-14817616 TAGTAATGTTAGATGTTTCAGGG + Intergenic
951177321 3:19617073-19617095 TAGTAGTTATATATATTTATAGG + Intergenic
951860486 3:27246437-27246459 TAGTAGGTGTATATGTTTATGGG + Intronic
951904917 3:27695651-27695673 TAGTAGGTGTATATGTTTATGGG - Intergenic
952433530 3:33249052-33249074 TAGTAGGTGTATATGTTTATGGG + Intergenic
952478773 3:33738139-33738161 TAGAATTATTACATGTTTATTGG - Intergenic
954487311 3:50865026-50865048 TAGTAGATTTATATATTTATGGG + Intronic
955020070 3:55111339-55111361 TAGAAATTTTAGATGTATATGGG - Intergenic
955154614 3:56404676-56404698 TAGTAGGTGTATATGTTTATGGG - Intronic
955508827 3:59659006-59659028 TATTAGTCTTGGTTGTTTATTGG - Intergenic
955679070 3:61481491-61481513 TAATAGTTTTACATATTTATGGG - Intergenic
956831845 3:73058539-73058561 TAGTAGGTTTACATATTTATGGG + Intronic
957369733 3:79277734-79277756 TAGTAGTTGTATATATTTATGGG - Intronic
957433323 3:80142461-80142483 TAGTAGGCGTATATGTTTATGGG + Intergenic
957537300 3:81523370-81523392 TAGTAGGTATATATGTTTATGGG + Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
957671756 3:83313998-83314020 TAATAATCTTATATATTTATAGG + Intergenic
957686442 3:83508241-83508263 TAGTAGTTGTATATATTTATGGG - Intergenic
957760789 3:84553396-84553418 TAGTAATTGTACATGTTTATTGG - Intergenic
957895560 3:86417403-86417425 TAGTAGGTGTATATGTTTATGGG + Intergenic
958619566 3:96539680-96539702 TAGTAGTTTTATATGTGAATAGG - Intergenic
959443595 3:106409935-106409957 TAGTAGGCATATATATTTATGGG + Intergenic
959509701 3:107196797-107196819 TAGTAGGCGTATATATTTATGGG - Intergenic
959956357 3:112242788-112242810 TAGTAGTTGTATATATTTATGGG - Intronic
960219509 3:115088355-115088377 TAGCAGACTTACAAGTTTATTGG - Intronic
960235493 3:115277313-115277335 TAGTAGTTGTATATATTTATGGG + Intergenic
961233234 3:125339763-125339785 TAGTAGGTGTATATGTTTATGGG - Intronic
961987215 3:131148868-131148890 TAATAGTCGTACATATTTATGGG + Intronic
963519965 3:146351258-146351280 TAGTAGTTGTATATATTTATGGG + Intergenic
965105834 3:164351210-164351232 CAGTAGTTTTTGAGGTTTATTGG + Intergenic
965594210 3:170392112-170392134 TAATAGTATTAGATGCTTAATGG + Intronic
965726551 3:171722883-171722905 TAGTAGGTTTATATATTTATGGG + Intronic
965748001 3:171945790-171945812 TAGTAGTTATACATATTTATGGG + Intergenic
965809211 3:172575083-172575105 TAGTAGGCGTACATATTTATGGG + Intergenic
965833332 3:172823358-172823380 TGATAGTCTTACATGTTTAATGG - Intergenic
965896241 3:173579963-173579985 TAGTAGGTATATATGTTTATGGG + Intronic
965906760 3:173717822-173717844 TAGTAGGTTTATATATTTATGGG - Intronic
966069543 3:175858735-175858757 TAGTAGTTGTACATATTTATGGG - Intergenic
966292594 3:178377714-178377736 TAGTAGTTGTATATATTTATGGG + Intergenic
966374851 3:179285927-179285949 TAGTAGTTTTATGTATTTATGGG - Intergenic
966979047 3:185113546-185113568 TACTAGTGTTAGTTATTTATAGG - Intronic
969120022 4:4901299-4901321 TAATAGTCATATATATTTATGGG + Intergenic
970413591 4:15834918-15834940 TAATAGTTTTACATATTTATGGG + Intronic
971762925 4:30791518-30791540 TTGCAGACTTAGATGTTCATGGG + Intronic
971841160 4:31854095-31854117 TAGTAGTTGTATATATTTATGGG - Intergenic
975185637 4:71399352-71399374 TAGTAGTCATAGAGGTTTATAGG + Intronic
975242185 4:72073310-72073332 TTGTAGTTGTATATGTTTATGGG - Intronic
975707882 4:77128768-77128790 TAGTAGGTTTATATGTTTATGGG + Intergenic
976062109 4:81140408-81140430 TAGTAGGCATATATATTTATGGG - Intronic
976109331 4:81654384-81654406 TAGTAGGCTTATATATTTATGGG + Intronic
976544231 4:86315510-86315532 TAGTAGGTGTATATGTTTATGGG - Intronic
977623833 4:99167937-99167959 GAGTATTTTTATATGTTTATTGG + Intergenic
977736127 4:100418281-100418303 TAGTAGATGTAGATATTTATGGG + Intronic
977989915 4:103429317-103429339 TAGCAGTCCAAGAAGTTTATTGG + Intergenic
978097543 4:104796638-104796660 TAGTAGGCGTATATATTTATGGG + Intergenic
978535958 4:109762772-109762794 TAGTATTTTTAGATATTTTTAGG - Intronic
978650715 4:111001113-111001135 TAGTAGGTTTATATATTTATAGG - Intergenic
978847129 4:113286872-113286894 TGGTAGCCTTACATGTTTACGGG - Intronic
978973525 4:114839998-114840020 GAGTAGTCTTACATGTTTCTTGG + Intronic
979292637 4:118994733-118994755 TAGATGTCCAAGATGTTTATGGG - Intronic
980348184 4:131652002-131652024 TACTAGTTTTACATGTTTATGGG - Intergenic
980694057 4:136333245-136333267 GAGTATTTTTATATGTTTATTGG - Intergenic
981332224 4:143524569-143524591 TAGTAGTCTTAGATGTTTATTGG + Intronic
981558163 4:146017696-146017718 TAGTAGGTGTAGATATTTATTGG + Intergenic
982298733 4:153857716-153857738 TACTAATCTTAAATGTTAATGGG - Intergenic
982487242 4:155980869-155980891 TAGAACTCTTTGATGTGTATTGG + Intergenic
982599368 4:157426679-157426701 TAGTAGTTGTACATATTTATAGG + Intergenic
983503823 4:168530816-168530838 TAGTGGTCATTGATGGTTATAGG - Intronic
983676573 4:170301440-170301462 TAGTAGGCATATATATTTATGGG - Intergenic
983724608 4:170905071-170905093 TAGTACCCTTAGATAATTATTGG - Intergenic
983774192 4:171585373-171585395 AAGTAGTCTTCCATGTTCATTGG + Intergenic
984219269 4:176953788-176953810 TAGTAGGTATATATGTTTATGGG + Intergenic
984230424 4:177091033-177091055 TAGTAGGTGTATATGTTTATGGG + Intergenic
984305685 4:177987004-177987026 TAGTAGTTGTACATATTTATGGG + Intronic
984613591 4:181869601-181869623 TAGTAGTTGTATATATTTATGGG - Intergenic
985187172 4:187330458-187330480 TACTAGTTTTAGATAATTATAGG - Intergenic
986521725 5:8626420-8626442 TAATTGGCTTATATGTTTATGGG - Intergenic
987007925 5:13730032-13730054 TAGTAGTACTAGATGTTTGAAGG + Intronic
987009281 5:13744593-13744615 TAGTAATTGTACATGTTTATGGG - Intronic
987211699 5:15690419-15690441 TAGTAATTTTACATATTTATGGG + Intronic
987400655 5:17472726-17472748 TAGTAGCTGTATATGTTTATAGG - Intergenic
987440811 5:17954002-17954024 TAATAGTTGTAGATATTTATGGG - Intergenic
987462224 5:18225277-18225299 TATTAGGCATACATGTTTATGGG - Intergenic
988152346 5:27400496-27400518 TAATAGTTGTATATGTTTATAGG - Intergenic
989186586 5:38632125-38632147 TAGTCCTCTTGGATTTTTATAGG - Intergenic
989572005 5:42953700-42953722 GAGCAGTTTGAGATGTTTATTGG - Intergenic
989786065 5:45332203-45332225 TAGTAGTTGTATATATTTATGGG + Intronic
991536697 5:67676714-67676736 TTGGAGTTTTAGAGGTTTATTGG - Intergenic
992136416 5:73750643-73750665 TAGTTGTTTTATATTTTTATTGG + Intronic
992636505 5:78730027-78730049 TAGTAGTTATATATATTTATGGG + Intronic
993948892 5:94149455-94149477 TAGTAGGCATATATATTTATGGG - Intergenic
994060369 5:95469910-95469932 TATTTGTCTTATATTTTTATAGG - Exonic
994589618 5:101757556-101757578 TAGTAGGTATACATGTTTATTGG - Intergenic
995228474 5:109731095-109731117 TAATAGTTGTACATGTTTATGGG + Intronic
995432404 5:112095579-112095601 TAGTAGGTGTATATGTTTATGGG - Intergenic
995807886 5:116074477-116074499 TAGTAGGTATAGATATTTATGGG + Intergenic
995892912 5:116976510-116976532 TAGTTTACATAGATGTTTATAGG - Intergenic
996801042 5:127403318-127403340 TAGTAGTTGTATATATTTATGGG + Intronic
998581560 5:143382279-143382301 TAGTAGGCATATATATTTATGGG - Intronic
999667139 5:153924848-153924870 TAGTAGGTATATATGTTTATGGG - Intergenic
999771276 5:154777796-154777818 TAGTAGGTTTACATATTTATGGG - Intronic
999945000 5:156585958-156585980 TACTAATATTAGATGTTAATAGG - Intronic
1003118451 6:3299097-3299119 TAGTAATCGTACATATTTATGGG - Intronic
1004153404 6:13143392-13143414 TAGTAGTTGTATATATTTATGGG - Intronic
1004513456 6:16301901-16301923 TAGTAGTCACAGATGTTAAAGGG + Exonic
1008809736 6:55481511-55481533 TAGTAGTTATATATATTTATGGG - Intronic
1009381128 6:63031456-63031478 CAGTAGTCTTAGTTGTGGATGGG + Intergenic
1009728477 6:67565669-67565691 TAGTAGGTTTATATATTTATGGG + Intergenic
1010015037 6:71095014-71095036 TAGTAGTTGTATATATTTATGGG - Intergenic
1010412001 6:75571069-75571091 TATTAACCTTAGATGTATATGGG + Intergenic
1010545768 6:77153605-77153627 TAGTAGTTGTATATATTTATGGG + Intergenic
1012111086 6:95234566-95234588 TAGTAGTTGTATATATTTATGGG + Intergenic
1012150345 6:95742067-95742089 TAGTAGGTGTATATGTTTATGGG - Intergenic
1012454491 6:99389558-99389580 TAGTAGGATTGGTTGTTTATAGG - Intronic
1013050161 6:106525571-106525593 TAGCAGTGATATATGTTTATGGG + Intronic
1013567790 6:111385359-111385381 TAGTAGACATATATATTTATGGG - Intronic
1013766825 6:113584240-113584262 TAGTACTTTCAAATGTTTATAGG + Intergenic
1014244355 6:119051627-119051649 TAGTACTCGTATATATTTATGGG - Intronic
1014590510 6:123261081-123261103 TAGTAGTTGTATATATTTATGGG - Intronic
1014663746 6:124208843-124208865 TAATAGTTGTAGATATTTATGGG + Intronic
1015428836 6:133105825-133105847 TAGCAGTTGTATATGTTTATGGG + Intergenic
1015439423 6:133231306-133231328 AAAAAGTATTAGATGTTTATGGG + Intergenic
1015889600 6:137956534-137956556 TAGTAGGTATATATGTTTATGGG + Intergenic
1016569287 6:145494282-145494304 TAGTAGTCTCTGGTGTTTGTTGG + Intergenic
1018407101 6:163498120-163498142 CAGTAGTCTTATTTGCTTATAGG + Intronic
1020283141 7:6661303-6661325 TAGTAGGCGTATATATTTATGGG - Intergenic
1020765643 7:12316817-12316839 TAGTAGATGTATATGTTTATAGG - Intergenic
1021418207 7:20413702-20413724 TAGAATTCTTAGATTTTAATGGG - Exonic
1023313455 7:38910941-38910963 CTGTAGTCCTAGAGGTTTATGGG - Intronic
1023686264 7:42738553-42738575 TGGTAGTGTTGGATGTTTGTAGG - Intergenic
1024887060 7:54155497-54155519 TGATAATCTTAGATGTTCATGGG + Intergenic
1024887277 7:54158518-54158540 TTATAGTTTTAGATATTTATGGG - Intergenic
1027226240 7:76245465-76245487 TAGTAGTTATACATATTTATAGG + Intronic
1027760529 7:82273008-82273030 TAGTAGTATTAGTTCTTTATTGG - Intronic
1028027142 7:85858108-85858130 TAGTAAACTTAGGTTTTTATAGG - Intergenic
1028060546 7:86308815-86308837 TAGTACTCATATATGTTTATGGG + Intergenic
1028449769 7:90968182-90968204 TGGTAAACTTAGATGTTTGTGGG + Intronic
1028751696 7:94390443-94390465 TAGAATGCTTACATGTTTATGGG - Intergenic
1028781438 7:94742032-94742054 TAATAAACTTAGATGTTTAAGGG + Intergenic
1029898481 7:104012471-104012493 TAGTTATCTTCTATGTTTATTGG - Intergenic
1029962056 7:104698377-104698399 AAGTAGACTTAGATTTTTTTGGG + Intronic
1029965281 7:104733712-104733734 TATTAGTCTTAGATGTAAATGGG - Intronic
1030679461 7:112419625-112419647 TAGTAGGTTTATATATTTATGGG - Intergenic
1031251437 7:119388160-119388182 TAGAAGACTGAGATTTTTATAGG + Intergenic
1031304632 7:120110770-120110792 TAGTAGGCATATATATTTATGGG + Intergenic
1033488670 7:141818111-141818133 TAGTAGGCGTATATATTTATAGG + Intergenic
1033725074 7:144107148-144107170 TAGTAGGCATATATATTTATGGG + Intergenic
1033813681 7:145047330-145047352 TAGTAGTTGTATATATTTATGGG + Intergenic
1035454722 7:159000496-159000518 TAGTAGGCATATATATTTATGGG + Intergenic
1037461311 8:19112757-19112779 TAGTAGGCATATATATTTATGGG + Intergenic
1037600864 8:20392560-20392582 TAGGAGTGTTTGCTGTTTATAGG - Intergenic
1038314335 8:26470067-26470089 TAGTAATTGTATATGTTTATGGG - Intronic
1041055732 8:53984282-53984304 TAGTAGTCTATGATGATAATAGG + Intronic
1041366057 8:57105957-57105979 TAGTAGACGTATATATTTATGGG - Intergenic
1042062271 8:64834121-64834143 TAGCAGTCTTAAATGTGTATGGG - Intergenic
1042358510 8:67855615-67855637 TAGTAGGTTTACATATTTATGGG - Intergenic
1042967217 8:74367216-74367238 TAGTTTTCTTACATGTTTACTGG + Intronic
1043298997 8:78703771-78703793 TACTAGTCTTAAATGTAAATGGG - Intronic
1043836910 8:85059161-85059183 TAGTAGTTGTATATATTTATGGG + Intergenic
1044010367 8:86986273-86986295 GAGCAGTTTTATATGTTTATTGG + Intronic
1044105016 8:88193699-88193721 TAATAGTCCTATATATTTATAGG - Intronic
1045104817 8:98882278-98882300 TAGTAGATGTATATGTTTATGGG + Intronic
1047056376 8:121169172-121169194 TAGTATGCTTATATGTTAATGGG - Intergenic
1047804090 8:128341000-128341022 TAAGAGTCTAAGATGTTTCTGGG + Intergenic
1048584883 8:135766149-135766171 TAGTAGGCATATATATTTATGGG - Intergenic
1048738202 8:137525299-137525321 TAGAAAGCTTAAATGTTTATAGG - Intergenic
1051432731 9:16996842-16996864 TAGTAGGTGTATATGTTTATGGG - Intergenic
1051718088 9:20006579-20006601 TAGTAGTTTTGTATATTTATGGG - Intergenic
1051790329 9:20795174-20795196 GAGTAGTTCTAGATGTTGATAGG + Intronic
1052421518 9:28248726-28248748 TAGTAGTTGTATATATTTATGGG - Intronic
1054824763 9:69562194-69562216 TAATAGTCATACATGTTTGTGGG - Intronic
1056932706 9:90892075-90892097 TACTAGTTTTACATGTTTATGGG + Intronic
1058144420 9:101396049-101396071 TAATAGTTGTAGATATTTATGGG - Intronic
1058175136 9:101726784-101726806 TAGTAGGCATATATATTTATGGG + Intronic
1058240350 9:102549633-102549655 TTGAAGTCTTAGTTATTTATTGG + Intergenic
1059233850 9:112745658-112745680 TAGTAGGCATATATATTTATGGG + Intergenic
1059631243 9:116125087-116125109 TAGTAGGCATATATATTTATGGG + Intergenic
1060081632 9:120652677-120652699 TAATAGTCATATATATTTATAGG + Intronic
1186276480 X:7944584-7944606 TAGTAGGCATATATATTTATGGG + Intergenic
1186622762 X:11258865-11258887 TAGTAGGTTTATATATTTATGGG + Intronic
1187105956 X:16242039-16242061 TAGTAGGTGTATATGTTTATGGG + Intergenic
1187120284 X:16399090-16399112 TAGTAGGTGTATATGTTTATGGG + Intergenic
1187498763 X:19820393-19820415 TAGCAGTCCTAAATGTGTATGGG - Intronic
1187724513 X:22188635-22188657 TAGTAGTTGTAAATATTTATGGG + Intronic
1187776289 X:22762047-22762069 TATTAGTATTAAATGTTTTTGGG + Intergenic
1187787345 X:22906755-22906777 TAGTAGGTGTATATGTTTATGGG + Intergenic
1188066038 X:25660777-25660799 TAATAGTTTTACATATTTATGGG + Intergenic
1188466126 X:30483369-30483391 TAATAGTCATACATATTTATGGG - Intergenic
1188765913 X:34090233-34090255 TAGTAGGCATATATATTTATAGG + Intergenic
1188973140 X:36641577-36641599 TAGTAGGTGTATATGTTTATGGG + Intergenic
1189247351 X:39573775-39573797 TACTAGTCATACATATTTATGGG + Intergenic
1189684834 X:43553204-43553226 TAGCAGTATAAGATGTGTATTGG + Intergenic
1189870546 X:45378298-45378320 TAGTAGTTGTATATATTTATGGG - Intergenic
1189981756 X:46517966-46517988 TAGTAGGTATATATGTTTATGGG - Intronic
1190558276 X:51660376-51660398 AAATAGTCTTATATATTTATGGG + Intergenic
1191056939 X:56251785-56251807 TAGTAGGCGTATATATTTATGGG + Intronic
1191801427 X:65085373-65085395 TAGTAGGTATATATGTTTATGGG - Intergenic
1192074242 X:67975003-67975025 TGGTAGGCTTAAATATTTATGGG - Intergenic
1192398163 X:70805984-70806006 TATTAGTCTTAGATGAATTTTGG - Intronic
1192725367 X:73745460-73745482 TAGTAGACGTATATATTTATGGG + Intergenic
1193022783 X:76809200-76809222 TAGTAGGTGTATATGTTTATGGG - Intergenic
1193209564 X:78790015-78790037 TATTAGTCTTAAATGTAAATGGG + Intergenic
1193279883 X:79634674-79634696 TAGTAGTTATATATATTTATAGG + Intergenic
1193487949 X:82110279-82110301 TAGTAGTGTCATATATTTATGGG + Intergenic
1193898122 X:87139863-87139885 TAGTAGATGTATATGTTTATGGG - Intergenic
1194035172 X:88862238-88862260 TAATATTTTTACATGTTTATGGG + Intergenic
1194385677 X:93251781-93251803 TAATAATTTTAGATATTTATGGG + Intergenic
1194668933 X:96706820-96706842 TAATATTCATACATGTTTATAGG - Intronic
1194745064 X:97619219-97619241 TAGTAGTATTAGATTCTTAGAGG - Intergenic
1194818270 X:98472232-98472254 TAATATTCCTAGAAGTTTATCGG + Intergenic
1194942272 X:100025504-100025526 TAGTAGGTATATATGTTTATGGG - Intergenic
1195074736 X:101315772-101315794 TAGTAGATGTATATGTTTATGGG + Intergenic
1195583721 X:106537681-106537703 TATTGGACTTGGATGTTTATAGG - Intergenic
1195813895 X:108864373-108864395 TAGTAGTTGTACATATTTATGGG + Intergenic
1195919156 X:109965435-109965457 TAATAGTTTTATATATTTATGGG - Intergenic
1196250918 X:113459234-113459256 TAGTAGTTATATATATTTATGGG - Intergenic
1196298539 X:114028166-114028188 AAGTAGTTTTACATGTTTAGGGG - Intergenic
1196316532 X:114232176-114232198 TAGTAGTTTTATATATTTATGGG + Intergenic
1196486417 X:116215399-116215421 TAGTAGGCGTATATGTTTATGGG + Intergenic
1196490731 X:116262753-116262775 TAGTAGTTGTATATATTTATGGG + Intergenic
1196588799 X:117461358-117461380 TAGTAGTTATATATATTTATGGG + Intergenic
1196779967 X:119375061-119375083 TAGCAGTGTAAGAAGTTTATTGG - Intergenic
1197117895 X:122854637-122854659 TAGTAGGCATATATATTTATGGG - Intergenic
1197508830 X:127345125-127345147 TAGTAGGTGTATATGTTTATGGG - Intergenic
1197916145 X:131537772-131537794 TAGTAGTTGTATATATTTATGGG + Intergenic
1197970873 X:132113661-132113683 TAGTAGTCGTATATATTTATGGG + Intronic
1198644499 X:138791043-138791065 TAGTAGTTGTATATATTTATGGG - Intronic
1199341459 X:146682375-146682397 TAGTAGGCATATATATTTATGGG + Intergenic
1199580528 X:149355730-149355752 TAGTAGGCGTATATATTTATGGG + Intergenic
1199660211 X:150041809-150041831 TAGTAGTTGTATATATTTATGGG + Intergenic
1202094884 Y:21239481-21239503 TATTAATCTTAAATGTTAATGGG - Intergenic