ID: 981332643

View in Genome Browser
Species Human (GRCh38)
Location 4:143530552-143530574
Sequence GCATATTTATGATGGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981332643 Original CRISPR GCATATTTATGATGGGAAAA AGG Intronic
900198540 1:1390458-1390480 GCAGCTTTATGCTCGGAAAAAGG - Exonic
900219969 1:1503246-1503268 GCATATGTATCATGATAAAATGG + Intergenic
900867400 1:5278090-5278112 AATTATTTAAGATGGGAAAAGGG + Intergenic
902078131 1:13803487-13803509 GGACATTGATGATGGGAAGAAGG - Intronic
902171881 1:14618338-14618360 TCATCTTCCTGATGGGAAAATGG - Intronic
902544916 1:17184168-17184190 GCATCTTTATGAGGAAAAAAAGG - Intergenic
903361345 1:22779247-22779269 GCATCTTTTTGATGGCAAATTGG - Intronic
903529793 1:24021451-24021473 GCATATTTGTGGGGGGAAATAGG - Intergenic
904317109 1:29672741-29672763 GCAAGTTCATTATGGGAAAATGG + Intergenic
906630211 1:47361003-47361025 ACATATTTATGAGGGGAATTGGG + Intronic
909273539 1:73655112-73655134 GCATAGTTATGAGGGCTAAATGG + Intergenic
909694248 1:78448125-78448147 GGTAATTTATGAAGGGAAAAAGG + Intronic
909797041 1:79753805-79753827 ACATATTTAGGATAGAAAAAAGG + Intergenic
912884030 1:113450210-113450232 GCATAATTGTGAAGTGAAAAAGG + Intronic
915263265 1:154694737-154694759 GCATAGTTGGGATGGGAGAAGGG + Intergenic
916772555 1:167926448-167926470 ACATTTTTACGAAGGGAAAAAGG + Intronic
916983294 1:170163123-170163145 GCATATTTATGTTGGAAAAGAGG + Intronic
917754359 1:178084441-178084463 TCTTATTTATAATGGGATAATGG - Intergenic
918092508 1:181309718-181309740 GCATATTTGGGAAGGAAAAAAGG - Intergenic
918363042 1:183778641-183778663 GAAAATCTAGGATGGGAAAAAGG + Intronic
918400173 1:184155112-184155134 TCATGTTTATGCTTGGAAAAGGG - Intergenic
918790662 1:188823159-188823181 ACCTATTTATTAAGGGAAAATGG - Intergenic
919000363 1:191824148-191824170 GCATATTTATCAGGGAAGAAGGG - Intergenic
919435669 1:197556555-197556577 GCATAATGAAGATGTGAAAATGG - Intronic
921228619 1:213046147-213046169 GCATAGTGGTGTTGGGAAAAGGG - Intergenic
922097214 1:222452612-222452634 GCAGCTTCATGATGGGAATAGGG - Intergenic
1063331447 10:5163841-5163863 GCGTTTTTATGTTGGGACAAAGG - Intergenic
1064228699 10:13510144-13510166 GAATACTAATGATGGAAAAATGG + Intronic
1064276599 10:13912048-13912070 GCATATTCATTTTGGGAAACTGG - Intronic
1064594721 10:16932071-16932093 GCCGATTGCTGATGGGAAAAAGG + Intronic
1064904208 10:20328043-20328065 TCATATTTATGAACAGAAAATGG + Intergenic
1068044558 10:51869690-51869712 GCATAATTATGAAGAGAGAAAGG + Intronic
1068219372 10:54025085-54025107 GAATATTTATTATGGTAGAATGG + Intronic
1068363282 10:56009495-56009517 GAACATATATGATGGCAAAAGGG + Intergenic
1070577446 10:77689949-77689971 TCAAATTAATGTTGGGAAAAAGG + Intergenic
1071389664 10:85159647-85159669 GCATATTTTTAAAGGTAAAAGGG - Intergenic
1071837687 10:89435785-89435807 CCATATTAATGATGGGAGCAGGG - Intronic
1071849817 10:89557677-89557699 GCATACTCTTGATGGGAACAGGG - Intergenic
1072218283 10:93306308-93306330 GCATATTTATAAAGGGTATATGG + Intergenic
1073601582 10:104851201-104851223 TCCTATTTATTATGGGAAAGAGG + Intronic
1074997538 10:118770736-118770758 GCATAGTTAGGTGGGGAAAAAGG - Intergenic
1075309588 10:121402112-121402134 GAAGATTTATAATGAGAAAAAGG - Intergenic
1076088273 10:127655582-127655604 GCATATATATGATGAAAAGAGGG - Intergenic
1079450105 11:20593461-20593483 ATATATTTATTATGGGAAATAGG - Intergenic
1079610209 11:22423778-22423800 GCATATTTGTGATGGCAAAGAGG + Intergenic
1080269007 11:30430895-30430917 GCACATGTATGATGGGTGAATGG - Intronic
1080629851 11:34064075-34064097 ACATTTTTATGCTAGGAAAATGG + Intronic
1081134898 11:39428501-39428523 GCTAATTTATTATGGCAAAATGG - Intergenic
1082188361 11:49211160-49211182 GCATATTTATTTAGAGAAAAGGG - Intergenic
1086029010 11:82330388-82330410 GAATATTTGTGAAGGGTAAATGG - Intergenic
1086104266 11:83132361-83132383 TCATTTTTTTGATGGGAGAAAGG - Intergenic
1088085343 11:105971613-105971635 CCACATTTATGTGGGGAAAATGG + Intronic
1088919871 11:114253009-114253031 TCATGTTTATAATGTGAAAAGGG + Intergenic
1090001356 11:122961988-122962010 AGATATTTGTGATGGCAAAATGG - Intergenic
1091158570 11:133397935-133397957 CCATATTAATGATGGGTAAATGG - Intronic
1091361700 11:134983086-134983108 ACATATTTATGTTTGGATAAGGG + Intergenic
1092778450 12:11964133-11964155 GGATTTTACTGATGGGAAAAAGG + Intergenic
1094325874 12:29238183-29238205 GCATATATGTAGTGGGAAAAGGG - Intronic
1095607259 12:44084196-44084218 ACATATTTATTATTGGAACAAGG + Intronic
1096427549 12:51516937-51516959 TCATCTCTAAGATGGGAAAAGGG + Intergenic
1096448109 12:51713006-51713028 GCATAATTGTGAAGTGAAAAAGG - Intronic
1098446942 12:70575732-70575754 GCATAAATATATTGGGAAAATGG + Intronic
1098952128 12:76651012-76651034 TCATATTTATAATGAGCAAATGG + Intergenic
1099288804 12:80749213-80749235 GCATATGTATTGTGGGGAAAGGG + Intergenic
1100105967 12:91172472-91172494 CCATTTTTAAGATGGAAAAAGGG - Intronic
1101202806 12:102454618-102454640 GCCTATTTAAGAATGGAAAAGGG + Intronic
1102090657 12:110184581-110184603 ACATACTTATGAAGGGTAAAGGG + Intronic
1103029667 12:117602678-117602700 GCATATTCATAATAGCAAAAAGG - Intronic
1106096949 13:26655109-26655131 GCATTTGTATGGTGGGAAAGTGG - Intronic
1107185426 13:37513583-37513605 GCATATTTAGGATTGCAAAGTGG + Intergenic
1108125425 13:47237674-47237696 GAATCTTTATGAGAGGAAAAGGG + Intergenic
1108293336 13:48985464-48985486 GAAAATGTATGATGGGAAACTGG + Intronic
1109683989 13:65788471-65788493 GCATAATTGTGAAGTGAAAAAGG - Intergenic
1111696059 13:91625976-91625998 GCATATTTTTGAAGTGATAATGG + Intronic
1111786094 13:92788802-92788824 TCATATTTGTGAAAGGAAAATGG + Intronic
1113102123 13:106732281-106732303 GGAAATTTTTGGTGGGAAAAGGG + Intergenic
1114853489 14:26409145-26409167 GCATATATATGGGGGGATAAGGG - Intergenic
1115177700 14:30583372-30583394 TCATTTTTATGATGAGGAAATGG + Intronic
1116015121 14:39396717-39396739 GCATCTTTGTGGTGGGGAAATGG + Intergenic
1116450659 14:45060963-45060985 GCATATGTATGGTGAGAAATAGG - Intronic
1116715354 14:48419173-48419195 CCATTTTTAAGATGGGAAAATGG + Intergenic
1117214238 14:53533785-53533807 ACATTTTTATGATTGGGAAATGG - Intergenic
1120641066 14:87013475-87013497 CCATTTTTATGATGGTACAATGG - Intergenic
1120839045 14:89067109-89067131 GCATAAATAAGATAGGAAAATGG + Intergenic
1121548072 14:94777262-94777284 GCTTATTCCTGATGGGAAAGAGG + Intergenic
1121673830 14:95735758-95735780 GCATGGATATGCTGGGAAAAGGG - Intergenic
1124104491 15:26724740-26724762 GAATATTTATGAAGGAAGAAAGG - Intronic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1126549940 15:49917545-49917567 CCATATATTTAATGGGAAAATGG - Intronic
1126575537 15:50192843-50192865 TCATCTTAATGAGGGGAAAATGG - Intronic
1128733943 15:70040686-70040708 CCATCTTCATGGTGGGAAAATGG - Intergenic
1129796823 15:78384052-78384074 AGATATTGATGATGGGACAAGGG + Intergenic
1129974124 15:79807108-79807130 GCATATCAATGTTGGAAAAAAGG + Intergenic
1131639266 15:94272544-94272566 GCATTGTTTTGATGGGAGAATGG - Intronic
1132374166 15:101317719-101317741 GCTTATTTCAGATGGGGAAAGGG - Intronic
1133689741 16:8201779-8201801 TCATATTTGGGATGGTAAAACGG - Intergenic
1134163216 16:11909215-11909237 GTAGAATTATGATGGGAAACTGG + Intronic
1135651738 16:24212233-24212255 GCATTTTTATCATGGGCAAATGG + Intronic
1135938644 16:26802075-26802097 GCATATCTGTGGTGGGAAAGGGG + Intergenic
1136296346 16:29305700-29305722 GAATATTTGGGATGGGAAAAGGG - Intergenic
1138713976 16:59000678-59000700 TCAAATTTCTGATGAGAAAATGG - Intergenic
1139019926 16:62736253-62736275 GCATAATCATGAAGTGAAAAAGG + Intergenic
1140574637 16:76152216-76152238 GCATTTTTATGTTGTGAAGATGG + Intergenic
1142057939 16:88011844-88011866 GAATATTTGGGATGGGAAAAGGG - Intronic
1143073639 17:4320187-4320209 CTATATTTATGATTAGAAAATGG + Intronic
1143930362 17:10416741-10416763 GCATCTGTATGATGGGCACATGG - Intronic
1144307056 17:13978275-13978297 GGATATTAATGAAGAGAAAAAGG + Intergenic
1147868330 17:43569216-43569238 GCAGATTTATGCAGAGAAAACGG + Intronic
1149211763 17:54311648-54311670 ACAATTGTATGATGGGAAAAAGG - Intergenic
1154319832 18:13339034-13339056 ACATATTTTTGTAGGGAAAAAGG + Intronic
1154493618 18:14939961-14939983 ACATATTTATGTTTGGATAAGGG - Intergenic
1156015228 18:32539682-32539704 AAATATTTAAGATGTGAAAATGG + Intergenic
1156864621 18:41874949-41874971 CTATATTTATCATGGAAAAAGGG - Intergenic
1157174466 18:45438740-45438762 CTATATCTATGATAGGAAAATGG + Intronic
1158649038 18:59270590-59270612 CTATATTTATGAAGGGAAATGGG + Intronic
1161196274 19:2988242-2988264 GCAGAGTAGTGATGGGAAAAGGG - Intronic
1167175880 19:47864033-47864055 GCATATCAATGAATGGAAAATGG + Intergenic
1168489171 19:56793518-56793540 GCATAGTTATGATTGGACAGTGG + Intronic
925047133 2:781041-781063 GGATGTTTCTGTTGGGAAAAAGG - Intergenic
926419402 2:12682052-12682074 CCATTATTCTGATGGGAAAATGG + Intergenic
929394432 2:41506657-41506679 TTATATTTATTATGGGTAAAAGG + Intergenic
930443482 2:51439820-51439842 GCATCATTATGATTAGAAAATGG - Intergenic
931144873 2:59506727-59506749 GCATATTAATTATGGCAAATGGG - Intergenic
931220043 2:60281018-60281040 GCAAAAGTATGATGGGAAACAGG + Intergenic
933330247 2:80884376-80884398 CCATTTTTAGGATTGGAAAATGG + Intergenic
934051040 2:88211237-88211259 GCAAATTTATGAATAGAAAAAGG - Intergenic
934843019 2:97643199-97643221 GAATATTCATCATGGGAGAATGG + Intergenic
936402340 2:112174933-112174955 ACATGATTATTATGGGAAAAGGG + Intronic
936999184 2:118448501-118448523 ACATATTTAAGATGCTAAAAAGG - Intergenic
937419585 2:121742470-121742492 TCATATTCATGTTGGGAAAGGGG + Intronic
939250995 2:139681258-139681280 GCATATTATTGATGCAAAAAAGG - Intergenic
940019814 2:149145035-149145057 GCATATTTTTTCTGGGAAGAGGG + Intronic
940083081 2:149827041-149827063 GCATCTTTATGATGAGGAAATGG - Intergenic
940320920 2:152375482-152375504 TCATATTTAGGATGAAAAAATGG + Intronic
940640268 2:156338001-156338023 GCAGAATTCTGATGAGAAAAAGG - Intronic
941265523 2:163356954-163356976 GCATATTTAGAAGGGGTAAAAGG - Intergenic
942560796 2:177216528-177216550 GCATAATTGTGAAGTGAAAAAGG + Exonic
942726694 2:179016861-179016883 TCATATTTCTGAAGGGTAAAAGG + Intronic
943683856 2:190796150-190796172 GGATATTTATGATGGGATTTTGG - Intergenic
943766734 2:191671027-191671049 GCATATATACAAAGGGAAAATGG + Intergenic
945430062 2:209753843-209753865 GGATTTTTATGTTGGGAAACAGG - Intergenic
945633506 2:212316449-212316471 GAAGATTGATGATGGAAAAAAGG - Intronic
945697427 2:213125232-213125254 GCATATTTATTAAAGGATAATGG - Intronic
947056140 2:226106672-226106694 AGATATTTAAAATGGGAAAATGG - Intergenic
1169838710 20:9909963-9909985 GCATTTTTATGTGGAGAAAATGG + Intergenic
1172611829 20:36258279-36258301 CCATTTTGCTGATGGGAAAATGG + Intronic
1173242481 20:41309753-41309775 GGATATTTAGGATGGAGAAAAGG - Intronic
1173321355 20:41990098-41990120 ACTTATTTATGAAAGGAAAAGGG - Intergenic
1174151841 20:48491456-48491478 GTATATGTATGATGAGCAAATGG + Intergenic
1178049731 21:28734440-28734462 TCATATTTATAATGGTGAAAAGG + Intergenic
1179599077 21:42463912-42463934 GCATATTTATGGACAGAAAAAGG + Intergenic
1180755941 22:18161287-18161309 GCATTTTTCGGATGGGAAAAAGG - Intronic
1181075827 22:20376116-20376138 GCATTTTTCGGATGGGAAAAAGG + Intronic
1184307947 22:43620365-43620387 GCATATTAAATATGAGAAAACGG + Intronic
949237186 3:1823429-1823451 GAATAATTATGATGGGACAAGGG + Intergenic
949285622 3:2400282-2400304 ACATATATATTATGGAAAAATGG - Intronic
949589402 3:5477882-5477904 GAATTTTTATGATGGGGAGAAGG - Intergenic
951557367 3:23934206-23934228 GCATATATGTGATGGAACAAAGG - Intronic
951564722 3:24002004-24002026 GTATATTTATTATGGGAATTGGG + Intergenic
952996312 3:38886045-38886067 GGATAGTTATTATGGAAAAATGG - Intronic
954020041 3:47732143-47732165 GCATTTTTATGTTCTGAAAACGG + Intronic
955883728 3:63575380-63575402 ACATCTTTATGATGAGAAAGAGG - Intronic
956194741 3:66641740-66641762 GCATTTGTTTGATGGCAAAATGG + Intergenic
957618017 3:82556684-82556706 ACATATTTGTGATGGATAAATGG + Intergenic
959366179 3:105460675-105460697 GAAGAGTTATGATGGGAGAAGGG - Intronic
962161721 3:133008164-133008186 ACATATTCATGATGGTGAAATGG - Intergenic
962501036 3:135992820-135992842 GCATATATAAGATGAGAAACGGG + Intronic
964363356 3:155922052-155922074 GGATACTTATGATGGGCAGATGG + Intronic
965150440 3:164967337-164967359 GAATATTGAAGATGGAAAAAAGG + Intergenic
966110227 3:176392153-176392175 GCATGCTGATGAGGGGAAAATGG - Intergenic
967107608 3:186266974-186266996 ACATTTTTAAGATGGGAAGATGG + Intronic
967335457 3:188339091-188339113 GCATATTTTTGAGGGGAGAGAGG + Intronic
971318149 4:25584384-25584406 GCATTTTTCAGATGGGAAAAGGG + Intergenic
971456038 4:26845016-26845038 GGATTTTAATGATAGGAAAATGG - Intergenic
972310358 4:37876580-37876602 GCATATATATGAAAGGAAAATGG + Intergenic
973141080 4:46768484-46768506 GCAAAATTCTGGTGGGAAAATGG + Intronic
975271590 4:72441690-72441712 GCACATTTGTCATGGGGAAAAGG + Intronic
975400189 4:73928272-73928294 GCATGCTAATGATAGGAAAAAGG + Intergenic
976872881 4:89817106-89817128 ACATATTTACCCTGGGAAAAAGG - Intronic
977627888 4:99208089-99208111 GATTTTTTATGCTGGGAAAAGGG + Intronic
977718054 4:100206309-100206331 GAATATTTATGAAAAGAAAAAGG - Intergenic
978123068 4:105104708-105104730 GCATATTGCTGTTGGAAAAATGG + Intergenic
979008241 4:115332566-115332588 GCACATTTCTAATGGGAAGAAGG - Intergenic
981332643 4:143530552-143530574 GCATATTTATGATGGGAAAAAGG + Intronic
981598407 4:146454535-146454557 GCAGATATATCATGGAAAAAGGG + Intronic
981894448 4:149781390-149781412 GCATATATATGCTGGACAAATGG - Intergenic
981912627 4:149999170-149999192 TTATTTTTATGATAGGAAAAAGG + Intergenic
983432190 4:167664799-167664821 TTATATTTTTAATGGGAAAATGG - Intergenic
983800004 4:171916004-171916026 GCATATTTATGTTCTAAAAATGG - Intronic
984094485 4:175417156-175417178 ACAAATTTATAATGGTAAAAAGG + Intergenic
986298613 5:6460520-6460542 GTAGATTTATGAGGGCAAAAAGG - Intronic
991121732 5:63023721-63023743 TCATTTTTATAATGGTAAAATGG - Intergenic
993191233 5:84684569-84684591 GCATATTTTTGAGGGGTAGAGGG + Intergenic
994212950 5:97106394-97106416 GAAGATTTATGAGGGGAAAAGGG + Intronic
994264304 5:97696761-97696783 GAATATTTAAGAAAGGAAAAAGG - Intergenic
995490759 5:112689337-112689359 GCTTATTTTTGATGGGCAAATGG - Intergenic
997509268 5:134442166-134442188 GAACATTTATTATGGGAAACAGG + Intergenic
998245422 5:140498270-140498292 GCATAATTGGGATGGGAGAAGGG - Intronic
999601221 5:153267689-153267711 GCATAAATATGCTGGAAAAAGGG - Intergenic
1000466162 5:161579842-161579864 GCATATTAATGATAACAAAAAGG + Intronic
1002327836 5:178421076-178421098 GCCTATTTATTAAGAGAAAATGG - Intronic
1004432104 6:15554683-15554705 GAATATTTATGAAAGGAGAAAGG + Intronic
1004765261 6:18719781-18719803 GCATATTCAATATGGGAGAAAGG - Intergenic
1004832429 6:19491521-19491543 TCCTATTTAGGATGGTAAAAAGG + Intergenic
1005352892 6:24953785-24953807 GCAGATGTATGATTGGACAAAGG - Intronic
1007436230 6:41813630-41813652 ACAAATTTGTAATGGGAAAAGGG - Intronic
1007899850 6:45400380-45400402 CAATATTTGTGGTGGGAAAAAGG - Intronic
1009025127 6:57990184-57990206 GAAAATTTATGAAGAGAAAAAGG + Intergenic
1010323909 6:74543467-74543489 GCTTATTAATGATGGAAAGATGG - Intergenic
1010388324 6:75308222-75308244 GCAAATTCATGATGTGAAAGAGG + Exonic
1010565317 6:77404410-77404432 CCGTATTTATGATTAGAAAAGGG - Intergenic
1011728039 6:90230670-90230692 GCAAAGTTATGATGGGAATGTGG + Intronic
1012526853 6:100188090-100188112 GCATAAAAGTGATGGGAAAATGG - Intergenic
1013101712 6:106992710-106992732 GCATGTTTATGAAAGGAAAGGGG - Intergenic
1015103033 6:129503666-129503688 GCATTTTTATGGTGGCTAAAAGG + Intronic
1015743802 6:136487935-136487957 TCATACTTATTCTGGGAAAAGGG + Intronic
1016158858 6:140850545-140850567 ACATATTTCTGATGGGACATGGG + Intergenic
1016340470 6:143056965-143056987 GCGTATTTATGATACTAAAATGG - Intergenic
1017180929 6:151551292-151551314 GCATATTTATCCTGAGAATAAGG + Intronic
1017208594 6:151830526-151830548 GCATATGGATGATAGAAAAAAGG - Intronic
1018564226 6:165134973-165134995 TCATATTTATAAACGGAAAAGGG + Intergenic
1018929462 6:168231025-168231047 GGGGATTTATGATGAGAAAACGG - Intergenic
1019877689 7:3829187-3829209 TCAAATTTATGATGAAAAAATGG + Intronic
1022170912 7:27829484-27829506 GTATATATCTAATGGGAAAATGG + Intronic
1022183138 7:27941274-27941296 GCTCATTTATGAAGGAAAAAGGG - Intronic
1022403647 7:30065520-30065542 GCATATTTCTTCTGGGATAATGG + Intronic
1023303391 7:38798013-38798035 GAATATATCTGATGGGAAGATGG - Intronic
1024503369 7:50138190-50138212 GCCTATTTATGTTGGGAAAATGG - Intronic
1026614740 7:71891544-71891566 CCATTTTATTGATGGGAAAATGG - Intronic
1027757987 7:82240350-82240372 GCTTATCTATGATGGCAGAATGG - Intronic
1028020322 7:85763548-85763570 GCATGTATATTATAGGAAAAGGG - Intergenic
1028483791 7:91336467-91336489 CCATTTTAAAGATGGGAAAATGG - Intergenic
1028525373 7:91778989-91779011 GCAAATGTATGATGAGAAACAGG + Intronic
1028721555 7:94038594-94038616 GCGTATTTATGAGAAGAAAAGGG - Intergenic
1030877825 7:114837516-114837538 GCAAATTTGTGATAGGTAAAAGG + Intergenic
1031027689 7:116698055-116698077 GCATAATTCTGATAGGACAAAGG - Intronic
1031165859 7:118225868-118225890 GCATATATTTGGTGAGAAAATGG - Intronic
1036212112 8:6850672-6850694 GCATATGTATGGTGGGAAGTGGG - Intergenic
1036790960 8:11719540-11719562 GTATATTTATTATAGAAAAATGG + Intronic
1038278778 8:26143768-26143790 GCATAATTCTGAGAGGAAAATGG - Intergenic
1039897069 8:41724230-41724252 CCATTTTTAGGATGGGCAAATGG + Intronic
1040682041 8:49822501-49822523 TAATATGTATGATGAGAAAATGG - Intergenic
1040856352 8:51952594-51952616 GCATATCAATGATGGCCAAAGGG - Intergenic
1040893092 8:52337993-52338015 GCATCTTTATGTAGGGAATATGG + Intronic
1042852575 8:73231146-73231168 AAATATTTAGGATGGGAAGATGG - Intergenic
1042897711 8:73689325-73689347 AAATATTTATGATGTTAAAATGG - Intronic
1043312790 8:78883014-78883036 GTATATGTATGATATGAAAATGG + Intergenic
1043684418 8:83068548-83068570 GCATCTAGATGATGGGAGAAAGG + Intergenic
1043732209 8:83696458-83696480 GCATATTTTTTATGGTAAGATGG + Intergenic
1043789185 8:84441964-84441986 TCATTTTTATGATGTGAACAAGG - Intronic
1043827242 8:84943842-84943864 GAAGATTTATGAATGGAAAAAGG - Intergenic
1044296892 8:90538176-90538198 GCATGCTTATAATGGGAAATTGG - Intergenic
1044666587 8:94639665-94639687 TCATATTCATGATGTGAAACGGG - Intergenic
1046317172 8:112519237-112519259 GCATATTTATGTTAAGGAAAAGG - Intronic
1050290240 9:4146724-4146746 GCATATTTAGGATGGAGAATAGG - Intronic
1050735128 9:8753173-8753195 AAATATTTATAATCGGAAAAAGG - Intronic
1051807939 9:21016953-21016975 TTATATTTAGGTTGGGAAAAAGG - Intronic
1052563727 9:30118868-30118890 GCATTATTCTGAAGGGAAAAAGG + Intergenic
1052934906 9:34084973-34084995 GAATATTTATAAAAGGAAAAAGG - Intergenic
1055745351 9:79438276-79438298 GCATATTTGTCATTGGACAAGGG - Intergenic
1055922574 9:81476709-81476731 GCTTATTTATTATGGGAACCAGG + Intergenic
1057038120 9:91826441-91826463 GCATAGTTATGCTGGTACAATGG - Intronic
1057038282 9:91828235-91828257 GCATATTTTTGATGGTACAGTGG + Intronic
1058303827 9:103411057-103411079 GCATATATAAGATGCCAAAAAGG - Intergenic
1059544468 9:115162384-115162406 ACATATTTGAGATGCGAAAAGGG - Intronic
1060290344 9:122296719-122296741 GCATAATGATGATGTGAATAAGG - Intronic
1060372294 9:123085893-123085915 GCATCTTTATTAAGGTAAAAAGG + Intronic
1185865575 X:3620879-3620901 GCACATTTTAGATGGGTAAATGG + Intronic
1187879410 X:23832419-23832441 GCATATTTATAATGAGATATAGG + Intergenic
1188235511 X:27726155-27726177 GAATATTTATTATGGGGAAAAGG - Intronic
1190107897 X:47572426-47572448 GGAAAATTATGATGGGAAATAGG + Exonic
1193955501 X:87855998-87856020 GCATCTTTGTAATGGAAAAATGG - Intergenic
1194899531 X:99492257-99492279 GCTTATTTATGATCAGAAAATGG + Intergenic
1195779336 X:108443822-108443844 GCAAATATATGATGAGAAACAGG - Intronic
1195981636 X:110584583-110584605 GTATATATATGCTTGGAAAAAGG - Intergenic
1197024707 X:121734873-121734895 GCATAGTTAACATGAGAAAATGG + Intergenic
1197633924 X:128892764-128892786 GGATATTTCTGGTGGGAAAGAGG - Intergenic
1197918281 X:131559992-131560014 GAATAAATATGAAGGGAAAATGG - Intergenic
1198200527 X:134412382-134412404 GCACATTTATTATAAGAAAAGGG - Intronic
1199955972 X:152742708-152742730 GAATATTTATGAGGTGTAAAAGG - Intergenic
1200798125 Y:7360597-7360619 GCACATTTTAGATGGGTAAATGG - Intergenic
1200969968 Y:9141355-9141377 CCATATTTCTGATGGTGAAATGG + Intergenic