ID: 981333100

View in Genome Browser
Species Human (GRCh38)
Location 4:143535541-143535563
Sequence GGTTATCTGTAGAAGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 6, 3: 58, 4: 365}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981333100 Original CRISPR GGTTATCTGTAGAAGGTGGT TGG Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905465224 1:38148097-38148119 AGTTATCTGAAGAAGATGGTAGG - Intergenic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
907650913 1:56294035-56294057 GGTTGTCAGTGGAAGGTGGTAGG - Intergenic
907678189 1:56538041-56538063 GGCTATCTGTAGAAGGGAATGGG - Intronic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910576422 1:88769974-88769996 GGGTAACTGTAGAAGGTGATGGG + Intronic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
919665417 1:200286675-200286697 TGTTATCTGAAGAAGTTGTTAGG - Intergenic
921520338 1:216149043-216149065 GTTGTTCTGTAGAAGGTGCTTGG - Intronic
922064814 1:222126355-222126377 GGTAATATGTTGAAGATGGTTGG + Intergenic
922697161 1:227736238-227736260 GGGTGTCTGGAGAAGATGGTGGG + Intronic
923796044 1:237156693-237156715 AGTAATATGTAGAATGTGGTGGG + Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063717112 10:8539118-8539140 GGGTAACTGTGGAAGGTGGGTGG - Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069145760 10:64890437-64890459 GTTTATCTGCGGAAGATGGTAGG - Intergenic
1069153866 10:65000469-65000491 GAATAACTGTAGAAGGTGGTGGG - Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070119546 10:73562396-73562418 TGTGTTCTGTAGAAGGTGGAGGG - Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071286880 10:84157016-84157038 AGCTCTCTGTAGAAGGTGGAAGG - Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1073974526 10:109085915-109085937 GGTCCTCTCTAGAAGGTAGTGGG - Intergenic
1074297817 10:112207305-112207327 CCTTATCTGTAGAATGTGTTAGG - Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077381072 11:2237901-2237923 GGTTATCTGTGGATGGTGGCAGG - Intergenic
1078762290 11:14260940-14260962 GGTGTTCTGTAGACGGTAGTGGG - Intronic
1080677334 11:34439857-34439879 GGTTATCTGTAGAATGTAGAGGG + Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1081838322 11:46176183-46176205 GGTTCTGAGTAGAAGGGGGTGGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083740817 11:64710999-64711021 GGTTATTGGTACAAGGTTGTGGG - Intronic
1085901330 11:80703336-80703358 AGTAATCAGTAGAAGGTGTTAGG + Intergenic
1085966316 11:81531953-81531975 GCTTATCTGTCAAAGTTGGTGGG - Intergenic
1088449352 11:109965340-109965362 AGTTATCTGTGGAAGATGGCAGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089180889 11:116582147-116582169 TGTTGTCTTTAGAAGCTGGTGGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091612568 12:2023818-2023840 GGTGTTCTGAAGAAGGTGTTGGG - Intronic
1092068928 12:5616761-5616783 GGATTTCTGTATAAGGTGATGGG - Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093392086 12:18635562-18635584 GGTTATCTGCATAAGATGGCAGG + Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093812632 12:23508236-23508258 GTTGTTCTGTAGAAGGTGCTGGG + Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094295936 12:28904883-28904905 GGTTTTCTGAAGAAAATGGTAGG + Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099735783 12:86565012-86565034 AGTTATCTGCAGAAGATAGTAGG - Intronic
1100176730 12:92039054-92039076 GTGTATCTGTAGAAGTTGGAAGG - Intronic
1100231944 12:92617827-92617849 AGTTAGCTGTGGATGGTGGTGGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100316034 12:93445304-93445326 GGTTACCTGGAGCAGGTTGTGGG + Intergenic
1100682576 12:96943800-96943822 GTTTATCAGTAGAAAGTGGGTGG + Intronic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102414984 12:112753469-112753491 GGTTAACTGCAGAGGGTGATGGG + Intronic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1105622500 13:22082358-22082380 GGTCCTTTGAAGAAGGTGGTAGG - Intergenic
1106760035 13:32859092-32859114 AGTTATTTGTAGAGGGTGCTGGG + Intergenic
1107747293 13:43524098-43524120 GATGATGTGAAGAAGGTGGTTGG - Intronic
1110651101 13:77942080-77942102 GGTTCCCTGAAAAAGGTGGTAGG - Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1110896530 13:80759829-80759851 GGTTAACAGTAGATGGGGGTGGG - Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111408550 13:87843141-87843163 GATTAACTGTAACAGGTGGTTGG - Intergenic
1111784463 13:92769952-92769974 GGTTATATGTACAAGGTCTTGGG - Intronic
1112037131 13:95507197-95507219 GTTTATCTGTTGAAGATGGTAGG - Intronic
1112100462 13:96183471-96183493 GGTTATAATTAGAAGGGGGTGGG - Intronic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112755341 13:102626122-102626144 AGTTAACTGTAGGAGGTGGGAGG - Intronic
1112796956 13:103067682-103067704 GATTATGTGAAGAAAGTGGTCGG + Intergenic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1116058905 14:39896911-39896933 AGTTATCTGTAGAATATGGCAGG - Intergenic
1116068091 14:40009144-40009166 AGTTATCTGAAGAAGATGGGAGG - Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1121349415 14:93161583-93161605 CATTTTCTGTAGAAGGGGGTGGG + Intergenic
1122266410 14:100548944-100548966 GGTTGGGTGTAGCAGGTGGTTGG - Intronic
1123508997 15:20977140-20977162 GGTTACTTTTAGAAGGTGATTGG - Intergenic
1123566220 15:21550887-21550909 GGTTACTTTTAGAAGGTGATTGG - Intergenic
1123602482 15:21988174-21988196 GGTTACTTTTAGAAGGTGATTGG - Intergenic
1123988393 15:25665248-25665270 GTTTATCTGAAGAGGGTGGCAGG + Intergenic
1124243703 15:28052550-28052572 GGAAATCAGTAGAAGCTGGTGGG + Intronic
1124363623 15:29056148-29056170 GATTATCTTTAGAGCGTGGTGGG + Intronic
1127245725 15:57171945-57171967 GTTTAAATGTAGAAGGTGGCAGG + Intronic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1129359208 15:75013925-75013947 GGTGATCTGTAGCAGGGGGTGGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130417810 15:83710477-83710499 GGATGCCTGTTGAAGGTGGTGGG - Intronic
1131085787 15:89574942-89574964 GTTTATCTGCAGAAGGTAATCGG - Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1202974587 15_KI270727v1_random:277976-277998 GGTTACTTTTAGAAGGTGATTGG - Intergenic
1134837548 16:17374827-17374849 GGTTATGTGTGGGAGGTGGTGGG - Intronic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1141810498 16:86372429-86372451 GTTTATGTGTATAAGGGGGTGGG + Intergenic
1144270756 17:13613490-13613512 GGTGATCTTTTGAAGGAGGTGGG + Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146569472 17:33940295-33940317 GGTTCCCTGTAGAAGCTGGTTGG + Intronic
1149442604 17:56687511-56687533 TTTTATTTGTAGGAGGTGGTGGG - Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151364950 17:73611302-73611324 GGTTCTCTGTAGAAAGTGCCAGG - Intronic
1152143022 17:78549696-78549718 GGTCCTCTGTAGCGGGTGGTGGG + Intronic
1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG + Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154406553 18:14097047-14097069 GGTTTGATGGAGAAGGTGGTTGG - Intronic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155234306 18:23804165-23804187 GCTTATATGTAGACGGTGGCAGG + Intronic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156610898 18:38722918-38722940 GGTTATCAATGGAAGGGGGTTGG + Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157350188 18:46877183-46877205 GCTTATCTGAATAAGGTGGTGGG - Intronic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160419344 18:78733380-78733402 GGTGAAGTGGAGAAGGTGGTAGG - Intergenic
1163607947 19:18286030-18286052 GGTTTCTTGGAGAAGGTGGTGGG - Intergenic
1164819291 19:31232716-31232738 GGTTAACTGGAGCAGGGGGTAGG - Intergenic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
926517875 2:13871966-13871988 GGGTATCTGAGGAAAGTGGTGGG + Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
928717975 2:34085144-34085166 GGTTTTCTGTATAGGTTGGTAGG + Intergenic
928959773 2:36912148-36912170 GATAATCTGAAGAAGGTGGTAGG - Intronic
930418599 2:51120964-51120986 GGTTATAAGTAGAAGATGGTAGG - Intergenic
930487160 2:52024321-52024343 GTTGTTCTGTAGAAGGTGCTGGG + Intergenic
932671166 2:73739025-73739047 GGATAACTGTAGAATGTGCTGGG - Intergenic
934513833 2:94971601-94971623 TGTTGCCTGTAGAAGGTGGGAGG - Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935839098 2:107089451-107089473 AGTTTTCTGGAGAAGGTGGTGGG - Intergenic
935977761 2:108595950-108595972 GGTTATCTGTGGAGGGTGGAAGG + Intronic
936135376 2:109888479-109888501 GGTTATCTGTGGAGGGTGGAAGG + Intergenic
936209321 2:110483006-110483028 GGTTATCTGTGGAGGGTGGAAGG - Intergenic
936428508 2:112438245-112438267 GGTTATCTGTGGAGGGTGGAAGG - Intergenic
937316934 2:120937611-120937633 GGCAACCTGAAGAAGGTGGTAGG - Intronic
937336406 2:121065009-121065031 GGCTTCCTGTAGGAGGTGGTAGG - Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940171315 2:150832741-150832763 AGTTATCTGCAGAAGTTGATAGG + Intergenic
941536905 2:166734870-166734892 AGTTATCTGCAGATTGTGGTAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941838842 2:170056551-170056573 GTTTATTTGTAGAAGTTGGTAGG + Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943071719 2:183148965-183148987 GATTATCTATAGAAGGTGGGGGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
944815205 2:203369142-203369164 GGTTTTCTGTAGAAGGAGGGAGG + Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946703777 2:222437821-222437843 AGTTATCTGCAGAAAATGGTAGG + Intronic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1169262185 20:4147356-4147378 GTTTATCTTTAGAAGGTGAACGG - Intronic
1170890290 20:20369690-20369712 GGCGAGCTGTAGAAGGTGGCCGG - Exonic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1171295831 20:24016037-24016059 TGTTGTCTGGAGAAGGTGATAGG - Intergenic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1175745186 20:61451651-61451673 GGAAAACTGTAGAAGGTGGGAGG + Intronic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1179574051 21:42295991-42296013 GTTTGTCTTAAGAAGGTGGTGGG + Intronic
1180167610 21:46038101-46038123 GGCTATCTGGAGGAAGTGGTGGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181376005 22:22458787-22458809 GCTTATCTGAATAAGGTGGGGGG - Intergenic
1181420650 22:22795802-22795824 AGTTATCTGTAGAGGATGGCAGG - Intronic
1182080138 22:27522956-27522978 GGTTATCTGGAGAAGGAGGTGGG + Intergenic
1182505926 22:30782308-30782330 GGTTGTCTGCAGGAGGTGGAAGG - Intronic
1182657625 22:31903196-31903218 GGTTAGGTGTGGAAGGTGGAGGG - Intronic
1182657634 22:31903220-31903242 GGTTAGGTGTGGAAGGTGGAGGG - Intronic
1182657791 22:31903699-31903721 GGTTAGGTGTGGAAGGTGGGGGG - Intronic
1182920777 22:34076993-34077015 GGTTACCTGGAGAGGGTGTTCGG + Intergenic
1183548276 22:38467087-38467109 GGTTATCTGTGGCAGGAGGTGGG + Intergenic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
950227486 3:11247799-11247821 GTTTATCTGAATAAGGTGGGGGG + Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951305489 3:21055689-21055711 GGTTAACTGTAAAAGATGCTTGG + Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
954539799 3:51385712-51385734 GGTAACCTCTAGATGGTGGTGGG - Intronic
954764407 3:52900994-52901016 GGGGAGGTGTAGAAGGTGGTGGG - Intergenic
955259809 3:57376085-57376107 GCTTATCTGTAAAATGAGGTTGG + Intronic
956005514 3:64774650-64774672 GATTATCTGTGGAAAGTGCTTGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959377348 3:105602864-105602886 AGTTATCTGCGGAAGATGGTAGG + Intergenic
959562751 3:107801281-107801303 GGTTAGTGGTAGAAGGTGGAAGG + Exonic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959855527 3:111151878-111151900 GGTTATCTGTAGATGGGGGTAGG - Intronic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960583879 3:119303209-119303231 GGTTTTCTGAAGAAGGAAGTAGG - Intronic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
963634256 3:147774786-147774808 GGTTATCCCTAGAGTGTGGTGGG + Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
963702065 3:148638836-148638858 GGTCATCTGTGGATGGAGGTAGG + Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965835804 3:172851069-172851091 GGTTACCTACAGAAGTTGGTGGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966480564 3:180403936-180403958 AGTTATCTGCAGAGGGTGGTAGG - Intergenic
966777464 3:183555563-183555585 GCTCATCTGTAGAAGGTGCCAGG + Exonic
968349261 3:198039097-198039119 GGTTTGCTGATGAAGGTGGTTGG - Intronic
968349264 3:198039118-198039140 GGGTTGCTGAAGAAGGTGGTTGG - Intronic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973026945 4:45284483-45284505 GATTATATGTAGATGGTGGCAGG - Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
974088786 4:57288809-57288831 GGTGAATTGAAGAAGGTGGTGGG + Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974289565 4:59912712-59912734 AGTTAACTGTAGAAGATGGCAGG - Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975936066 4:79582418-79582440 GTTTAGATGTAGAAGTTGGTGGG - Intergenic
976122249 4:81795967-81795989 GGTTATATGTAGAAGGGGCCAGG + Intronic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978589365 4:110308070-110308092 GCTTATCTGTAGGAGGCGATTGG + Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
979414955 4:120425644-120425666 GGTTATATGTTGCAGGTGGATGG + Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
981333100 4:143535541-143535563 GGTTATCTGTAGAAGGTGGTTGG + Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987865641 5:23532928-23532950 TTTTTTCTGTAGAAGGTGGTTGG - Intergenic
987899466 5:23992603-23992625 GGTGAATTGTAGAAGGTGTTTGG + Intronic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
989045210 5:37267620-37267642 GGTTATCTGAAGAAGATGGTAGG + Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989717552 5:44482085-44482107 GGGTGTCTGTGGGAGGTGGTGGG + Intergenic
991229240 5:64311736-64311758 GATTATTGGTAGAAGATGGTAGG - Intronic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993319825 5:86458549-86458571 AGTTATCTGCAGAAGATAGTAGG - Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
997256606 5:132433626-132433648 GGTCACCTCTTGAAGGTGGTAGG - Intronic
999606450 5:153322047-153322069 GTTTATGTGAAGAGGGTGGTTGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003791217 6:9549963-9549985 AGTTATCTTCAGAAGATGGTAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008476788 6:51942001-51942023 GTTGTTTTGTAGAAGGTGGTGGG - Intronic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010368399 6:75079375-75079397 GGTTTTCTTTAGAATGTGGGTGG - Intergenic
1010714140 6:79208693-79208715 GCTTACCTGGAGAAGGTGATGGG - Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011047685 6:83103886-83103908 GGTTTTCACTAGAAGGGGGTAGG - Intronic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012645540 6:101674772-101674794 TGTTATGTGTAGAAGCTGTTAGG + Intronic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1014416983 6:121195361-121195383 GGTTATCTGCAGAAGATGGTAGG - Intronic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016589766 6:145731287-145731309 GGTTTTCTGTTGAAGTTGTTAGG - Intronic
1017036710 6:150273689-150273711 TGTTGTCTGGAGAAGGTTGTGGG - Intergenic
1017281603 6:152631734-152631756 GGGTATAGGTAGAAGGAGGTGGG + Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021237742 7:18163616-18163638 GGTTGTCTGTAGAGGCTGGTAGG - Intronic
1021274573 7:18633714-18633736 AGTGAAGTGTAGAAGGTGGTAGG + Intronic
1021468747 7:20977326-20977348 TTTAATCTGTAGAAGGGGGTGGG + Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024866099 7:53906315-53906337 AGTTATCTGAAAAAGGTGGCAGG - Intergenic
1025921575 7:65918126-65918148 GGTTATCTCTAGGAGGTTGCGGG - Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1033023852 7:137754087-137754109 GGTTATGTAAAGAAGGTGGGAGG + Intronic
1035983357 8:4398206-4398228 GATGATCTGTAGTATGTGGTGGG + Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1038060489 8:23907024-23907046 GATTATCCATAGAAGGTGATGGG - Intergenic
1038281287 8:26167486-26167508 GGGAGTCTGTTGAAGGTGGTGGG + Intergenic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042988559 8:74612213-74612235 GGATACCTGTAGAATGTGCTGGG - Intronic
1043503916 8:80884367-80884389 GTTTATATGGAGGAGGTGGTGGG - Intergenic
1044090841 8:87998785-87998807 GAGTATTTGTATAAGGTGGTTGG - Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045266386 8:100622138-100622160 GCTTATTTGTAGAATGTTGTTGG + Intronic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046128677 8:109941632-109941654 AGTTATCTGAAGAAGATTGTGGG + Intergenic
1048540154 8:135334950-135334972 TGTTATCTGCACAAGGTGCTGGG - Intergenic
1048836067 8:138520139-138520161 GGTTTTCTGTACATGGAGGTGGG - Intergenic
1050022290 9:1296723-1296745 GGTTATAGGTAGAATGTGCTTGG + Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051250944 9:15158074-15158096 AATAATCTGTAGAAGGTGATAGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1052718312 9:32145433-32145455 GGTGATAAGGAGAAGGTGGTGGG - Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056770027 9:89471484-89471506 TGTTATCTGGAGAGTGTGGTGGG - Intronic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1059424156 9:114210454-114210476 GGCTGTCTGGGGAAGGTGGTGGG + Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1187433528 X:19246557-19246579 GTTTATCTGTAGAAGGAGACAGG - Intergenic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188258305 X:27989481-27989503 GATTATGTTTAGAAGTTGGTGGG - Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1192673256 X:73168448-73168470 GGTTACCTGCAGAAGATGGCAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193132948 X:77937171-77937193 GGTTGTATGTATATGGTGGTAGG + Intronic
1193701597 X:84769328-84769350 GGGTATCTTTAGAAGGGGATTGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195822865 X:108965994-108966016 TGTTGTCTGTAGAACATGGTGGG - Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197521993 X:127510339-127510361 AGTTATCTGTAGATGGTGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1201184498 Y:11386572-11386594 GATTATGTGTAGAAGGTAGAGGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic