ID: 981340021

View in Genome Browser
Species Human (GRCh38)
Location 4:143610948-143610970
Sequence CAACCAGGACTACCCCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981340021_981340025 0 Left 981340021 4:143610948-143610970 CCTCTTGGGGGTAGTCCTGGTTG 0: 1
1: 0
2: 2
3: 5
4: 108
Right 981340025 4:143610971-143610993 GGTAATTAGATACTTGACTTAGG 0: 1
1: 0
2: 0
3: 7
4: 120
981340021_981340026 12 Left 981340021 4:143610948-143610970 CCTCTTGGGGGTAGTCCTGGTTG 0: 1
1: 0
2: 2
3: 5
4: 108
Right 981340026 4:143610983-143611005 CTTGACTTAGGTCCTCTCCCTGG 0: 1
1: 0
2: 1
3: 9
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981340021 Original CRISPR CAACCAGGACTACCCCCAAG AGG (reversed) Intronic
913210334 1:116577127-116577149 CAACCAAGACTGCCACCGAGAGG + Exonic
917637735 1:176953491-176953513 CATGCAGGACTTCTCCCAAGGGG + Intronic
920100218 1:203512700-203512722 CAACCATCACTACCCCCAGGAGG - Intergenic
920412820 1:205775269-205775291 CCACCGGGACTTCCCCCGAGCGG + Exonic
922413254 1:225396043-225396065 CAACCAGGGGGACCTCCAAGGGG + Intronic
923196405 1:231672651-231672673 CAACCAGGAGTAAGCCCAAGGGG - Intronic
923347235 1:233066393-233066415 CAACCAGAAAAAGCCCCAAGGGG - Intronic
924453446 1:244199261-244199283 CAAGCAGGATAACCCCCAGGGGG + Intergenic
1070421200 10:76239022-76239044 CAACCAGGCCAACTCCCAGGGGG + Intronic
1071508700 10:86248017-86248039 CAACAAGAGCTGCCCCCAAGGGG + Intronic
1074497025 10:113988153-113988175 CAACCAGGTTCACCCCCTAGGGG + Intergenic
1076905470 10:133358627-133358649 CCTCCTGGACTCCCCCCAAGGGG - Intergenic
1087711690 11:101560919-101560941 CAACCTGAACTACCCACAATAGG + Intronic
1090280445 11:125451693-125451715 CAAACAGTACGACCCCCAAAGGG - Intronic
1090876269 11:130791527-130791549 CAGCCATGACTTCCCCCTAGAGG - Intergenic
1091973112 12:4804716-4804738 CAACCAGGACTAGACCCCAGGGG - Intronic
1095434805 12:42175957-42175979 CCACCAAGCCTAGCCCCAAGTGG - Intronic
1100354547 12:93817234-93817256 CAGCCAGGTCTCTCCCCAAGTGG + Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1105265124 13:18808784-18808806 CAGCCAGGATTACCACCCAGGGG - Intergenic
1106029309 13:25985536-25985558 CGACCATGACTGCCCCCCAGCGG - Intronic
1109572136 13:64206792-64206814 CAACCAGCAGAAGCCCCAAGGGG + Intergenic
1118322966 14:64764117-64764139 CCCCCAGGACTATCCCCAAGGGG + Intronic
1118848352 14:69565282-69565304 CAACAAGGACTACCCCCAAAAGG + Intergenic
1120157684 14:81112080-81112102 CAACCTGGAATGCCACCAAGAGG - Intronic
1122079614 14:99257681-99257703 AAACCAGGATGTCCCCCAAGGGG + Exonic
1202833352 14_GL000009v2_random:59337-59359 CAGCCAGGATTACCACCCAGGGG + Intergenic
1202906463 14_GL000194v1_random:76442-76464 CAGCCAGGATTACCACCCAGGGG + Intergenic
1123552787 15:21398773-21398795 CAGCCAGGATTACCACCCAGGGG - Intergenic
1123553005 15:21400053-21400075 CAGCCAGGATTACCACCCAGGGG - Intergenic
1123589033 15:21836161-21836183 CAGCCAGGATTACCACCCAGGGG - Intergenic
1123589250 15:21837441-21837463 CAGCCAGGATTACCACCCAGGGG - Intergenic
1126085613 15:45008743-45008765 CTACCACGCCTAGCCCCAAGAGG - Intergenic
1126678348 15:51181388-51181410 CAATGAGGACTGCCGCCAAGAGG + Intergenic
1202961137 15_KI270727v1_random:125993-126015 CAGCCAGGATTACCACCCAGGGG - Intergenic
1202961353 15_KI270727v1_random:127273-127295 CAGCCAGGATTACCACCCAGGGG - Intergenic
1132846536 16:2003434-2003456 CCACCAGCTCTACCCCCAGGAGG + Intronic
1133727010 16:8547262-8547284 CAACCAGGATTTCTCCAAAGGGG + Intergenic
1139971508 16:70778789-70778811 GAAACAAGACTATCCCCAAGAGG - Intronic
1140466745 16:75189065-75189087 CAGCCAGGTCTACTCCCTAGTGG + Intergenic
1142171440 16:88624724-88624746 CAGCCAGGACCCCCCCCAGGAGG + Exonic
1147960993 17:44167527-44167549 CACCCTGGACTGCCACCAAGAGG + Intergenic
1151771294 17:76163783-76163805 GAACCAGGCCTTCCCCCATGAGG + Intronic
1153795622 18:8619257-8619279 CATCTAGGACTACGGCCAAGCGG - Intronic
1154423269 18:14252760-14252782 CAGCCAGGATTACCACCCAGGGG + Intergenic
1154453698 18:14502170-14502192 CAGCCAGGATTACCACCCAGGGG - Intergenic
1158432473 18:57401691-57401713 CAAACAGGATTAGCTCCAAGAGG + Intergenic
1160992514 19:1865497-1865519 CAACCAGCCCTGCCCTCAAGGGG + Intergenic
1161802990 19:6426095-6426117 GAGCCAGGACGACCCACAAGGGG + Exonic
1166301305 19:41913438-41913460 CCACCCGGACGACCCCCAGGCGG + Intronic
1167091808 19:47349414-47349436 CACCCCAAACTACCCCCAAGCGG - Intronic
932580687 2:72991093-72991115 CAGCCCTGCCTACCCCCAAGAGG - Intronic
934494779 2:94787822-94787844 CAGCCAGGATTACCACCCAGGGG - Intergenic
934683340 2:96302324-96302346 CAACCAGTACAGCCCACAAGAGG + Intronic
938280374 2:130059792-130059814 CAGCCAGGATTCCCACCAAGGGG + Intergenic
938281091 2:130064122-130064144 CAGCCAGGATTGCCACCAAGGGG + Intergenic
938281455 2:130066340-130066362 CAGCCAGGATTACCACCCAGGGG - Intergenic
938281530 2:130066866-130066888 CAGCCAGGATTGCCACCAAGGGG + Intergenic
938281726 2:130068080-130068102 CAGCCAGGATTACCACCCAGGGG - Intergenic
938332346 2:130456629-130456651 CAGCCAGGATTACCACCCAGGGG - Intergenic
938357463 2:130664039-130664061 CAGCCAGGATTACCACCCAGGGG + Intergenic
938357989 2:130667201-130667223 CAGCCAGGATTACCACCCAGGGG + Intergenic
938433895 2:131270826-131270848 CAGCCAGGATTACCACCCAGGGG + Intronic
938434285 2:131273219-131273241 CAGCCAGGATTGCCACCAAGGGG - Intronic
938434607 2:131275209-131275231 CAGCCAGGATTGCCACCAAGGGG - Intronic
946095001 2:217266757-217266779 AAGCCAGAACTACCCCCAACTGG + Intergenic
946133268 2:217624105-217624127 CAACCAGTGGTACCCACAAGAGG + Intronic
946828622 2:223705109-223705131 ACACCAGGACAACCCCCATGAGG + Intergenic
948995575 2:241576553-241576575 CCACCAGGCCTGCCCTCAAGGGG - Intergenic
1170722127 20:18891064-18891086 CAACAAGGCCTGCCCTCAAGAGG + Intergenic
1171885913 20:30652473-30652495 CAGCCAGGATTACCACCCAGGGG - Intergenic
1173441414 20:43080065-43080087 CTACCAGGCCTACCTCCATGGGG + Intronic
1174941760 20:54937089-54937111 CATTCAGGAGTACCACCAAGAGG - Intergenic
1176625809 21:9091241-9091263 CAGCCAGGATTACCACCCAGGGG + Intergenic
1176647642 21:9365967-9365989 CAGCCAGGATTACCACCCAGGGG - Intergenic
1176820483 21:13651135-13651157 CAGCCAGGATTACCACCCAGGGG + Intergenic
1176850206 21:13907249-13907271 CAGCCAGGATTACCACCCAGGGG - Intergenic
1180200190 21:46219532-46219554 CAGCCAGAACTTCCCCCAGGAGG + Exonic
1180362629 22:11913506-11913528 CAGCCAGGATTACCACCCAGGGG + Intergenic
1181089754 22:20464586-20464608 CAACCTAGCCTACCCCAAAGAGG + Intronic
1181173376 22:21022708-21022730 CGACGAGGACTGCCCCGAAGGGG + Exonic
959916568 3:111823099-111823121 CAACCAGGACAGCTTCCAAGTGG + Intronic
967679075 3:192338611-192338633 AAACAAGGACTACTCCCCAGCGG + Intronic
1202739237 3_GL000221v1_random:39020-39042 CAGCCAGGATTACCACCCAGGGG + Intergenic
968554437 4:1240119-1240141 CACCCAGGAGTCCCCCCAGGCGG - Intronic
970176446 4:13344469-13344491 CAACCTAGGCTACCACCAAGTGG + Intergenic
973369558 4:49234718-49234740 CAGCCAGGATTACCACCCAGGGG - Intergenic
973391474 4:49560698-49560720 CAGCCAGGATTACCACCCAGGGG + Intergenic
976196031 4:82531885-82531907 CAACCAGGACTAGCACTGAGAGG + Intronic
976820904 4:89205917-89205939 CAACCAGGAATACCTACACGGGG + Intergenic
980845425 4:138318595-138318617 CCACCAGGACTACCTCCAAGGGG + Intergenic
981340021 4:143610948-143610970 CAACCAGGACTACCCCCAAGAGG - Intronic
981341379 4:143625748-143625770 CAGCCACCACTACCCTCAAGAGG + Intronic
1202766672 4_GL000008v2_random:154228-154250 CAGCCAGGATTACCACCCAGGGG - Intergenic
985888846 5:2700344-2700366 CAACTAGGACTTCCCACATGAGG + Intergenic
987031662 5:13981624-13981646 CTACCAGGACAGCCCCTAAGAGG + Intergenic
990024873 5:51174343-51174365 CAACCAAACCTACCCCCTAGAGG + Intergenic
995266478 5:110167367-110167389 CTAACTGGACTACTCCCAAGTGG - Intergenic
997665110 5:135624284-135624306 AAACCGGGGCTACCCACAAGTGG + Intergenic
1002594714 5:180314374-180314396 CAAGCAGGAATGTCCCCAAGTGG + Intronic
1003459827 6:6319657-6319679 AAACCAGGCACACCCCCAAGAGG + Intronic
1008526011 6:52407834-52407856 TAACAAGGACTACCCTGAAGAGG + Intergenic
1011624630 6:89272916-89272938 CACCCGGGACTACTTCCAAGAGG - Intronic
1018641917 6:165911751-165911773 CTTCCAGGCCTACCCCCAAGAGG + Intronic
1019362760 7:613950-613972 CAAGCAGGGCTGCCACCAAGCGG + Intronic
1038118571 8:24585835-24585857 AAACCAGGAATTCACCCAAGGGG + Intergenic
1040453520 8:47573176-47573198 CAATCAGGACAAACACCAAGTGG - Intronic
1041418076 8:57635852-57635874 AAACAATGAATACCCCCAAGGGG + Intergenic
1049485623 8:142858449-142858471 CTTCCAGGACGACCCCCATGTGG + Intronic
1053662338 9:40292537-40292559 CAGCCAGGATTACCACCCAGGGG + Intronic
1054374467 9:64438766-64438788 CAGCCAGGATTACCACCCAGGGG + Intergenic
1054522272 9:66083747-66083769 CAGCCAGGATTACCACCCAGGGG - Intergenic
1203526767 Un_GL000213v1:97786-97808 CAGCCAGGATTACCACCCAGGGG - Intergenic
1203748982 Un_GL000218v1:61662-61684 CAGCCAGGATTACCACCCAGGGG + Intergenic
1203547425 Un_KI270743v1:139106-139128 CAGCCAGGATTACCACCCAGGGG - Intergenic
1196456782 X:115896469-115896491 GAACCATGACAACACCCAAGTGG - Intergenic