ID: 981340182

View in Genome Browser
Species Human (GRCh38)
Location 4:143613049-143613071
Sequence AGTTGCTAAAAAATGATAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 288}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981340180_981340182 7 Left 981340180 4:143613019-143613041 CCATCACTGCATGTTGCTTGTAT 0: 1
1: 0
2: 2
3: 9
4: 167
Right 981340182 4:143613049-143613071 AGTTGCTAAAAAATGATAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 288
981340179_981340182 23 Left 981340179 4:143613003-143613025 CCGTACAAGTTGGTGTCCATCAC 0: 1
1: 0
2: 1
3: 5
4: 71
Right 981340182 4:143613049-143613071 AGTTGCTAAAAAATGATAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981340182 Original CRISPR AGTTGCTAAAAAATGATAGT GGG Intronic
903631775 1:24779696-24779718 AGTTGCTCAAAGCAGATAGTAGG + Intronic
904230865 1:29070282-29070304 AAATGCTCAAAAATGATACTTGG - Intronic
908995840 1:70153058-70153080 ATTTACTAACAAATGAAAGTTGG + Intronic
909388794 1:75093326-75093348 TGTTACTAAAAAATCATAGATGG - Intergenic
909921400 1:81385217-81385239 TCTTGCTAAAGAATAATAGTGGG - Intronic
911424439 1:97689253-97689275 TGCAGCTAAAAAAAGATAGTTGG + Intronic
911463821 1:98225310-98225332 AGTTATTAAAAAATGATATTAGG - Intergenic
911542264 1:99171915-99171937 AGTTATTAAATAATGAAAGTTGG - Intergenic
911711279 1:101076515-101076537 AGTTGCTAAAGGATGACATTAGG - Intergenic
912536239 1:110374389-110374411 ATTTTTTAAAAAATGATAGTAGG + Intronic
912613767 1:111076373-111076395 AGATGCAAAAAAATGATAAAGGG - Intergenic
913150719 1:116040069-116040091 AGGTGCTAAAAAATAATGGTGGG - Intronic
913415685 1:118603978-118604000 AGTTGGTTAAAAATATTAGTGGG + Intergenic
913421564 1:118675567-118675589 AGTCTCTAAAAAATAATAGGAGG + Intergenic
915002198 1:152603663-152603685 ACCTGCTACAAAATGATACTGGG - Intergenic
916951354 1:169783787-169783809 TGTCGCAAAAAAATGATAATAGG - Intronic
917158718 1:172032903-172032925 TGATGCTAAAAAATTATCGTGGG + Intronic
917980069 1:180263612-180263634 AATTGCTAAAAAACGCTGGTGGG + Intronic
918026291 1:180751416-180751438 AGTACCTAATAAATAATAGTTGG + Intronic
918278276 1:182976248-182976270 ATTTTCTATAAAATGGTAGTTGG - Intergenic
918916510 1:190646851-190646873 AGTGCATAAAAAATAATAGTTGG - Intergenic
918927610 1:190808894-190808916 ATTTGCTTAAAAATTTTAGTAGG + Intergenic
919371335 1:196730813-196730835 AGTTATTATATAATGATAGTGGG - Intronic
920553297 1:206883689-206883711 AGTTGCTTTAAAATGATAACAGG - Intergenic
924061519 1:240180023-240180045 GTTTGGTAAAAGATGATAGTTGG + Intronic
1063092710 10:2881480-2881502 AATTGCTAAAAAATGCAAATGGG - Intergenic
1064487725 10:15813145-15813167 ACTTGTTAAAAATTGGTAGTGGG - Intronic
1065412187 10:25441741-25441763 AGTTGAGCAAAAATGATATTAGG - Intronic
1066245555 10:33580452-33580474 AGTTGATAAGAAATGATGGCTGG - Intergenic
1068089588 10:52416567-52416589 ATTTTCTAAAAGATGATAGCAGG - Intergenic
1068277532 10:54821800-54821822 AGTTCCTACAAAATGAAACTTGG - Intronic
1068344495 10:55756190-55756212 ATTTGCTTAAAAATCATATTTGG - Intergenic
1068436263 10:56994914-56994936 AGTTTCTAAAACATGAAACTTGG - Intergenic
1068803469 10:61168395-61168417 AGTTGCTATAAAATGTTTGTTGG + Intergenic
1069369105 10:67725043-67725065 AGTTGATAATAAATTATAGTGGG - Intergenic
1070862047 10:79678139-79678161 ATTTGCTTAAAAATCATATTTGG + Intergenic
1071642016 10:87318480-87318502 ATTTGCTTAAAAATCATATTTGG - Intergenic
1073035232 10:100560216-100560238 AGTTGCTAACAACTGATGCTGGG + Intergenic
1074072050 10:110081708-110081730 AATTGTTAAAAAATCATAATAGG - Intronic
1074103528 10:110372622-110372644 CATGGCTAAACAATGATAGTTGG - Intergenic
1075276803 10:121101262-121101284 AATTACTATAAAATGTTAGTTGG - Intergenic
1075409243 10:122215209-122215231 AGCTGTTAAAAAGTGAGAGTGGG + Intronic
1077764834 11:5147167-5147189 AGTTACTAAAGAATAATATTGGG - Intergenic
1078765157 11:14289475-14289497 CTTTGCTAAAATATGAAAGTAGG - Intronic
1078980794 11:16531284-16531306 ACTTGCTGAAAAATAATATTAGG - Intronic
1078981893 11:16545048-16545070 AGTTTTTAAAAAATGATATGGGG - Intronic
1080774717 11:35374758-35374780 AGTTATTAAAAAATAATAGATGG - Intronic
1081346971 11:42000013-42000035 AGTTTCAAAGAAATGATACTTGG - Intergenic
1081698025 11:45131870-45131892 AGTTGCTCAAAAATGTTATCCGG + Intronic
1081714217 11:45237136-45237158 AGTAGCTTAAAAATGCTACTTGG - Intergenic
1082664759 11:55962168-55962190 AGTTGGTTAGAAATGATAGCAGG - Intergenic
1086685718 11:89731098-89731120 AGTTGCTCAAAAATGAAATAAGG - Intergenic
1087315229 11:96594616-96594638 TGTTGCCAAAAAATGACTGTAGG + Intergenic
1087481868 11:98712161-98712183 AGTAGCTAATAAATTATAGTGGG + Intergenic
1087565006 11:99844652-99844674 AGTTGATTAAAAATTATATTTGG + Intronic
1088467307 11:110154740-110154762 ACTTTCTTAAAAATGATAATTGG + Intronic
1088798465 11:113284473-113284495 AGTTGCTGACAAATGTCAGTAGG - Intergenic
1090549224 11:127801305-127801327 ATTTACAAAAAAAGGATAGTGGG + Intergenic
1093360714 12:18223787-18223809 ATTTGCTCTAAAATGATGGTAGG - Intronic
1093505179 12:19856966-19856988 AGTTTCTAGAAAATGAAACTGGG + Intergenic
1093695857 12:22159487-22159509 ATATGCTAAAAAATAAGAGTTGG + Intronic
1094069645 12:26398500-26398522 AGATGCTGAAAAATCATATTTGG + Intronic
1094110325 12:26855161-26855183 AGCTGCTTGAAAATGATATTGGG - Intergenic
1094309746 12:29066707-29066729 AGTGGCTATAAAATAATAGAAGG + Intergenic
1094455780 12:30631350-30631372 AGTTACAAAAAAATTTTAGTAGG - Intronic
1094651452 12:32381180-32381202 TGTTGGAAAAAAATGATCGTTGG + Intronic
1095194890 12:39302507-39302529 ATTTCCTACAAAATGATAGTTGG - Intronic
1095244729 12:39906221-39906243 CTTTCCTAATAAATGATAGTTGG - Intronic
1095630422 12:44370194-44370216 AGTTGATTAAAAATGTTTGTTGG - Intronic
1096367329 12:51039746-51039768 AATTTTTAAAAAATGAAAGTAGG + Intergenic
1096859077 12:54510130-54510152 TGTAGCTAAAAAATCATGGTTGG + Intronic
1097440120 12:59597591-59597613 TGTGGCTGAAAAATGAGAGTTGG + Intronic
1098661302 12:73097933-73097955 ATTTGCATAAAAATGATAGTTGG - Intergenic
1098687896 12:73448841-73448863 AGCAGCTAAAAAATGATAAGCGG + Intergenic
1098854077 12:75632409-75632431 AGTTGCTAAAATATCATAAAGGG - Intergenic
1099064963 12:77964303-77964325 ATTTGCTACAAAATGTTAATAGG - Intronic
1099311307 12:81028018-81028040 AGAGGCTAAAACATGAAAGTGGG + Intronic
1099337604 12:81383429-81383451 AGTTACTAAAAAAAAATACTAGG - Intronic
1099804269 12:87498164-87498186 AGTTGTAAAAATTTGATAGTGGG + Intergenic
1101603398 12:106229869-106229891 AGTTTATAATAAATGACAGTAGG + Intergenic
1101971781 12:109319547-109319569 AGTTGGTAAACAATGTTAGGTGG + Intergenic
1102267875 12:111503888-111503910 GGTTTTTAAAAAATGAGAGTGGG - Intronic
1104090448 12:125512370-125512392 ATTTTGTAAAACATGATAGTGGG + Intronic
1104497767 12:129256961-129256983 AGCTGCTAAAACATCAGAGTGGG - Intronic
1105630422 13:22158077-22158099 AGTTGCTTTTAAAAGATAGTAGG + Intergenic
1106049855 13:26179933-26179955 AGTTGCTAAAGAATCAAAGAAGG + Intronic
1108115282 13:47120675-47120697 ATTGGCTTAAAAATGATAGGAGG + Intergenic
1109888547 13:68576007-68576029 AGTTGCTGAAAAACAATGGTGGG - Intergenic
1110155869 13:72315412-72315434 ATTAGCTAATAAATGATGGTAGG - Intergenic
1111270323 13:85873763-85873785 AGTTGCTATAAACTGAAATTGGG - Intergenic
1111697412 13:91642260-91642282 TGTAACTCAAAAATGATAGTTGG + Intronic
1112532633 13:100219755-100219777 AATTGGGAAAAAATGATAGTAGG - Intronic
1115591464 14:34869662-34869684 AGTTGCTACAATTTTATAGTTGG - Intronic
1115670505 14:35606853-35606875 AGTTACCAAATCATGATAGTGGG + Intronic
1116119033 14:40697667-40697689 TGTGGCAGAAAAATGATAGTAGG - Intergenic
1116923202 14:50603464-50603486 GGTTGCTGAAAAATAATAGAAGG + Intronic
1117157362 14:52953752-52953774 AGTTTCTAAACCATGACAGTTGG - Intergenic
1117251260 14:53941401-53941423 AATTACTAAGAAATGATACTTGG - Intergenic
1118100460 14:62594814-62594836 TTTTGCTTACAAATGATAGTAGG - Intergenic
1119541761 14:75443334-75443356 GCTTGCTAAAAAATGTCAGTGGG - Intronic
1120066731 14:80050137-80050159 AGTTTCTATAAAATGCTTGTTGG - Intergenic
1120409291 14:84131636-84131658 AGATGTTAACAAATGATTGTTGG + Intergenic
1121106701 14:91284681-91284703 AATTACTAAAATATGAGAGTCGG - Intronic
1123226576 15:17041788-17041810 AGATTCTACAAAATGACAGTTGG - Intergenic
1124837430 15:33208966-33208988 AGTTCCCAAAAAAAGATAATTGG + Intergenic
1126196972 15:45942726-45942748 AGTTACTAAATTCTGATAGTTGG + Intergenic
1126484217 15:49161340-49161362 AGGTGCTAATAAGTGCTAGTTGG + Intronic
1126769638 15:52042420-52042442 AGTGGGTAAAAAGTGATACTAGG - Intronic
1127648340 15:60980726-60980748 AGTTATTAAAAAATGAGAGAAGG - Intronic
1128441127 15:67709660-67709682 ACTTAGTAAAAAATGAGAGTGGG - Intronic
1128618612 15:69130076-69130098 AGTTGCTAAGGAATGAGACTAGG - Intergenic
1130678144 15:85972646-85972668 AGTTAATAAAAAATGATAAAGGG - Intergenic
1131714069 15:95089576-95089598 AGTTGTGTGAAAATGATAGTAGG + Intergenic
1133882232 16:9793382-9793404 ATTTTCAAAAAAATGATTGTGGG - Intronic
1134566213 16:15254169-15254191 ATTTACTACCAAATGATAGTGGG + Intergenic
1134736282 16:16502529-16502551 ATTTACTACCAAATGATAGTGGG - Intergenic
1138727224 16:59152973-59152995 AGTCTCTATAAAATGATAATTGG + Intergenic
1139688833 16:68625924-68625946 TGTTGCTAAAAAACAAAAGTAGG - Intergenic
1139798373 16:69500957-69500979 AGTTTTTAAAAAATGAAAGGAGG - Intergenic
1140343546 16:74189615-74189637 AGTTGCTGAGAAATTATAGAGGG + Intergenic
1143919025 17:10316158-10316180 AGTTTCAAAAAAATCATAATCGG + Intronic
1144940272 17:18934225-18934247 AGCTGCTAAAAAATGCCATTGGG - Intergenic
1146705405 17:34997402-34997424 AGGGGATAAAAAATGAGAGTTGG + Intronic
1147022038 17:37542807-37542829 AATTACTAAAAAAAGATAGGAGG + Intronic
1149824584 17:59816228-59816250 GATTGTTAAGAAATGATAGTAGG + Intronic
1150759530 17:67949063-67949085 ATTTATTAAAAAATGAAAGTAGG + Intronic
1153556102 18:6315829-6315851 ATTTTTTAAAAAATGAGAGTAGG - Intronic
1153682562 18:7514365-7514387 AGTTGTTAAAAAATAATAGGAGG + Intergenic
1155998087 18:32353324-32353346 TGTTGCTAAGAAATAAAAGTAGG - Intronic
1156065108 18:33132048-33132070 AGTCGTTAAAAAATGAGACTAGG - Intronic
1158745954 18:60200476-60200498 AGTTCCTAAAAATAGATATTTGG + Intergenic
1159526662 18:69600792-69600814 ATTTGTTAAAGAATGATATTTGG + Intronic
1159738332 18:72132662-72132684 ATTTGCTATAAACTGATAGTTGG + Intergenic
1163323472 19:16587995-16588017 AGCTGCTAAAAACAGAAAGTGGG - Intronic
1164977534 19:32584618-32584640 AGGTGCTAGAAATTTATAGTGGG - Intronic
1165222302 19:34326327-34326349 AACTGCTAAAAAATGTTACTTGG + Intronic
1166249002 19:41552789-41552811 ACCTGCTAAAACATAATAGTAGG + Intronic
924991071 2:313888-313910 ATTTGCTATGAAATGATAGTTGG + Intergenic
925647998 2:6056621-6056643 AGTTGCTGAAAAATAAAAGCAGG - Intergenic
926508485 2:13744851-13744873 TCTTGCTAAAAAAAGATTGTTGG + Intergenic
927938902 2:27091387-27091409 ATTAGAAAAAAAATGATAGTAGG - Intronic
927987866 2:27425826-27425848 AGTGGTTAAAAAATTAAAGTAGG + Intergenic
928556835 2:32435321-32435343 AGATGCTATAAAATGATTGGAGG - Intronic
928895887 2:36263033-36263055 AGTTGACAAAAAAAGAAAGTTGG - Intergenic
929202719 2:39254159-39254181 AGTTGAAAGAAAATCATAGTTGG + Intronic
930625227 2:53689343-53689365 ACTTGTTAAAAGATGAGAGTTGG - Intronic
932258594 2:70308045-70308067 AGATGTTAAAAAATTATATTTGG + Intergenic
932901560 2:75706794-75706816 AGTTGCTTAAGAAAGAAAGTTGG - Intronic
934070116 2:88376127-88376149 AGTTGGTTAATCATGATAGTGGG - Intergenic
936627826 2:114167224-114167246 GGTTGCAACAAAAAGATAGTGGG + Intergenic
936758647 2:115746231-115746253 AATTGCAACAAAATGATAATTGG - Intronic
939597823 2:144149079-144149101 AATTTTTAAAAATTGATAGTAGG - Intronic
939763744 2:146219438-146219460 ACTTGCAAAAAAAAGAAAGTTGG + Intergenic
939866408 2:147477803-147477825 AGTTTATAAAAAGTTATAGTGGG - Intergenic
940886598 2:158995269-158995291 AATTGCTAGAAACTGAGAGTTGG + Intronic
943773890 2:191744179-191744201 AGTAGTTTAAAAATGATAATGGG - Intergenic
944174679 2:196816700-196816722 AGTTGGAAAAAAATGTTAGAGGG + Intergenic
945509568 2:210684048-210684070 TGATACTAAAAAATGATTGTAGG + Intergenic
946903624 2:224395553-224395575 AGTGGGTGCAAAATGATAGTGGG - Intronic
948744513 2:240077857-240077879 TATTACCAAAAAATGATAGTTGG + Intergenic
1169242029 20:3990555-3990577 AGTTGTTAAAGAATGATACCAGG + Intronic
1169536040 20:6541747-6541769 AGTTGCTAGAAACTCAAAGTTGG + Intergenic
1169642105 20:7764143-7764165 ACTTTATAAAAAATGTTAGTTGG + Intergenic
1169707800 20:8525884-8525906 AGCTCCTAAAAAATGAAAATTGG + Intronic
1169856146 20:10105431-10105453 ATTTCTTAAAAAATGAAAGTAGG + Intergenic
1170945402 20:20886986-20887008 ATTTGCTATTCAATGATAGTGGG - Intergenic
1172212430 20:33210242-33210264 AGCTGCTAAAAATTTATTGTGGG - Intergenic
1175158629 20:56991476-56991498 AGTTGCTGAAGAATTATTGTTGG + Intergenic
1176323950 21:5368193-5368215 AGATTCTACAAAATGACAGTTGG - Intergenic
1176481709 21:7302200-7302222 AGATTCTACAAAATGACAGTTGG - Intergenic
1177065645 21:16430934-16430956 AGTTGTCAAAAAATAATAATAGG - Intergenic
1179361788 21:40716403-40716425 AGTTCCTAAAAAATAACTGTGGG + Intronic
1180400437 22:12415045-12415067 AGATTCTACAAAATGACAGTTGG - Intergenic
1180597412 22:16987753-16987775 TGTTGCTACAAAGTGATAATTGG - Intronic
1183000744 22:34856626-34856648 AGTGGTTGAAAAATGATGGTGGG + Intergenic
949565596 3:5242188-5242210 AGTTGCTTTAAAATGATAACAGG + Intergenic
950989941 3:17423011-17423033 AGTTTTTAAAAAATTAAAGTTGG - Intronic
950990343 3:17430493-17430515 AGGTGCAAAAAAATGGTAATAGG + Intronic
951103090 3:18711865-18711887 AGTTGCTAAATAATAAAAGTAGG - Intergenic
951169928 3:19529457-19529479 ATTTGCTAAAAAAGGATTGTTGG - Intronic
951268653 3:20599592-20599614 AATAGCCAAAAAATAATAGTGGG - Intergenic
953948030 3:47165192-47165214 AGTGGTTAAAAACTGAAAGTGGG + Intergenic
958501663 3:94918615-94918637 AGGTGCTCAAAAATATTAGTAGG - Intergenic
958815008 3:98904891-98904913 AGTTGCCAAACAATGACAGAAGG + Intergenic
959197004 3:103196624-103196646 AGTTAATACAAAATGTTAGTGGG - Intergenic
960494394 3:118357850-118357872 AGTTACTAGAAAATTATTGTGGG + Intergenic
960726974 3:120680485-120680507 AGTTGCTTAAACATGACAGCAGG + Intronic
960842183 3:121971018-121971040 ACATGCTAAAAACTGAAAGTAGG - Intergenic
960902855 3:122569237-122569259 AGTTTCTAAAAGTTTATAGTGGG - Exonic
963402726 3:144821854-144821876 AGTTTTTAAAGAATGAGAGTTGG + Intergenic
963457953 3:145570878-145570900 TCTTGCTGAAAAAAGATAGTTGG - Intergenic
965264630 3:166526004-166526026 AGATGCTAAAAAATGGTAGTTGG + Intergenic
965644082 3:170861546-170861568 ATTTCCTAAAAATTGATGGTCGG - Intergenic
965801616 3:172499573-172499595 ACTAACTAAAAGATGATAGTTGG - Intergenic
966101978 3:176280599-176280621 GGTTCTTGAAAAATGATAGTCGG - Intergenic
966631381 3:182079172-182079194 ATTTGCTATAAATTGGTAGTTGG + Intergenic
966643878 3:182220769-182220791 TGTTTCTAAAAAATGAAAGAGGG + Intergenic
966801778 3:183770755-183770777 AGTTGCAGAAAAATGTAAGTAGG - Intronic
967467971 3:189829403-189829425 ATTTTCTAAGAATTGATAGTTGG - Intronic
968239910 3:197069930-197069952 AGTTTCTAAGAAATATTAGTTGG - Intronic
970553973 4:17213055-17213077 AGATGCAAAAAAAGAATAGTAGG + Intergenic
972809434 4:42565667-42565689 ATTTGCTTCAAAATGATAGTGGG + Intronic
973270914 4:48262496-48262518 AGTTAAGAAAAAATGATATTTGG - Intronic
973285038 4:48405543-48405565 ATTTTCTATAAAGTGATAGTTGG + Intronic
974107558 4:57487542-57487564 AGTTGCTTATAAATGATATCTGG - Intergenic
974831098 4:67190720-67190742 AATTGCTAAAAAATGTGAGAAGG - Intergenic
975087444 4:70359567-70359589 GGTAGCTAATAAATGTTAGTAGG + Intergenic
975799921 4:78049700-78049722 AGTTGCCAGATAATGAGAGTGGG - Intergenic
976393229 4:84527380-84527402 AGTTATTAAATAATGACAGTTGG + Intergenic
979180933 4:117726269-117726291 ACTTTTAAAAAAATGATAGTAGG - Intergenic
980615776 4:135223130-135223152 ACTTACCAAAAAATTATAGTTGG - Intergenic
981340182 4:143613049-143613071 AGTTGCTAAAAAATGATAGTGGG + Intronic
982929436 4:161384312-161384334 TGTTGCAAAAAAATGTTAATGGG - Exonic
983084860 4:163430219-163430241 ATTTTCTAAAAAATGATACCAGG + Intergenic
985807162 5:2054379-2054401 AGATGCAAAAAAATTTTAGTTGG + Intergenic
985905499 5:2832219-2832241 AGTTGCTAAAATATGTATGTAGG - Intergenic
986528797 5:8711810-8711832 GGTTGCCAAAAAATGGTAATGGG + Intergenic
986698595 5:10381297-10381319 AGTGGCTAACAAATGTCAGTGGG + Intronic
987530834 5:19117019-19117041 AACTGCTACAAAATAATAGTGGG + Intergenic
990559445 5:56969012-56969034 AGTTTCTATAAAATGTTTGTGGG + Intronic
991083407 5:62625053-62625075 AGTTTCTGAAAAATTATAATTGG + Intronic
991620840 5:68544051-68544073 ACTTGCAGAAAAATGATATTGGG + Intergenic
992522568 5:77570406-77570428 AGTTGCTTACAAATGAAACTAGG + Intronic
992807659 5:80353421-80353443 AATTGCTAAAAAATAGTATTGGG + Intergenic
992915669 5:81450449-81450471 AGTTGCTTAAGAATGATGATAGG - Intronic
993499692 5:88651438-88651460 AATTGTTAAAAGATGATTGTGGG - Intergenic
993628906 5:90259988-90260010 TTTTGCTAAAATATGATAATCGG - Intergenic
993755309 5:91721899-91721921 TGTTGCTAAGAAAGGAGAGTGGG - Intergenic
993974719 5:94464622-94464644 TGTTGCTAAAAAATGATTCAAGG - Intronic
994061598 5:95484912-95484934 GGTTGCTAAAAAATTACCGTTGG + Intronic
994310715 5:98267430-98267452 AGATGCTAAAAACTTATAGGAGG + Intergenic
994822435 5:104670380-104670402 AGAAGACAAAAAATGATAGTAGG + Intergenic
998651060 5:144122314-144122336 AGTAGCTAGAAAATGGTAGAAGG - Intergenic
999123492 5:149228677-149228699 AGAGGCTAAAAAAAGTTAGTTGG - Intronic
1000825036 5:166034427-166034449 AGTTGCTATAATATAATACTGGG + Intergenic
1001622362 5:173098446-173098468 AGTTGCCAAAATATCATACTTGG + Intronic
1002148728 5:177208651-177208673 AGTTGCATAAAAAAGAAAGTAGG - Intronic
1004123366 6:12848400-12848422 GCTTGGGAAAAAATGATAGTAGG - Intronic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1008639257 6:53444601-53444623 AGATGATAGAAAATGAGAGTGGG + Intergenic
1009890908 6:69680656-69680678 TGTTGTTGAAAAATGATAGAAGG + Intronic
1010207064 6:73332436-73332458 ATTTTTTAAAAAATGATAGTAGG + Intergenic
1011080626 6:83486762-83486784 ATTTGCTTCAAAATGATACTGGG + Intergenic
1012426290 6:99118431-99118453 AGTTTTTAAAAAAAGATAATTGG - Intergenic
1013773883 6:113657406-113657428 ATTTACAAAAAAATGATAGTTGG + Intergenic
1014239642 6:119001106-119001128 AGATGACAAAAAATTATAGTAGG - Intronic
1014257820 6:119181338-119181360 AGTTTCTGAAAATTGATTGTAGG + Intronic
1014333308 6:120098893-120098915 TCTTATTAAAAAATGATAGTTGG + Intergenic
1014334045 6:120108924-120108946 ATATGTTAAAAAATGTTAGTAGG - Intergenic
1015803241 6:137081768-137081790 AGTTTTTAAAAGATGATAATAGG - Intergenic
1018549053 6:164973027-164973049 ACTTGCAAATAAAAGATAGTAGG + Intergenic
1019887889 7:3921317-3921339 ATTTGCTAAAAAAAGAAACTAGG - Intronic
1020398270 7:7743210-7743232 AGTTGCTTTAAAATTAAAGTAGG + Intronic
1020801639 7:12739907-12739929 TGTTGCTAAAAAGAGATACTTGG + Intergenic
1021331581 7:19344761-19344783 AGTTAATAAACAATGATAGAAGG - Intergenic
1022351900 7:29574118-29574140 AGATGACAAAAAAGGATAGTGGG + Intergenic
1023529664 7:41139153-41139175 TGTTGATAAAAAATGATAAGGGG + Intergenic
1023574361 7:41609944-41609966 AGTTGGTAAAAAATAATCGATGG - Intergenic
1025088493 7:56042965-56042987 ATTAGAGAAAAAATGATAGTTGG + Intronic
1027748665 7:82112088-82112110 AGTTAATGAAAAATGATATTAGG - Intronic
1028677691 7:93486127-93486149 ATTTGCTAATAAATTACAGTTGG - Intronic
1028951728 7:96644009-96644031 AGTTGTTACAAAGTGATGGTGGG - Intronic
1030305296 7:108011717-108011739 GCTTGCTAAAGAATGAGAGTGGG - Intergenic
1030813077 7:114000379-114000401 AATTACTCAAAAATGATGGTTGG - Intronic
1030984386 7:116223984-116224006 AGTTGCCAAAAAATGAAATGTGG + Intronic
1031512788 7:122670141-122670163 AGTTCAGAAAAAATGGTAGTGGG - Intronic
1032350042 7:131153632-131153654 TGTAGCTACAAAATGAAAGTAGG + Intronic
1033535127 7:142305183-142305205 TGTTGCTAAAAAATGACTGTGGG + Intergenic
1038143259 8:24869126-24869148 AGTTGCTTAAAAATGTTAATTGG + Intergenic
1038387485 8:27162800-27162822 AGTTCCTAAAAGATGTTCGTGGG + Intergenic
1039301630 8:36215547-36215569 AGTTGCTAATAAATGACCATTGG - Intergenic
1040119980 8:43673171-43673193 AGTTACTGAAAAGTTATAGTAGG - Intergenic
1041256198 8:55981374-55981396 AGATGCTCAAAAATGCTTGTTGG + Intronic
1041582262 8:59474867-59474889 AGGTACTAAAAGATGAGAGTCGG + Intergenic
1042023954 8:64402714-64402736 AGATGCAAAAAAATGATAAAGGG - Intergenic
1042538816 8:69887000-69887022 ATTTGCTTTAAATTGATAGTTGG - Intergenic
1043349039 8:79337176-79337198 AGTTGCTAAAAAAACATTTTGGG - Intergenic
1045590289 8:103586002-103586024 GGTTGCTATAAAATGATAAAAGG + Intronic
1047695599 8:127400808-127400830 AGCTGCTAAAAAATGCTGGAGGG - Intergenic
1048544414 8:135373041-135373063 AGTTCCTAGAAAATGAAAGGAGG + Intergenic
1048719406 8:137306010-137306032 AATTGCAAAATAATGATAATGGG + Intergenic
1051317516 9:15857722-15857744 ACTTGCTAAAGAATGAAACTGGG - Intronic
1051914591 9:22192983-22193005 AGTTGCTATTAAAAAATAGTAGG - Intergenic
1052699345 9:31919592-31919614 AATTGCTAAAAATAGCTAGTGGG - Intergenic
1055369720 9:75584197-75584219 AAATGCTAAAAAATGAAAGAAGG - Intergenic
1055398481 9:75898283-75898305 AGTTTCAAAAAAATGATTGTGGG + Intronic
1055850113 9:80616849-80616871 AGTTGCTGAAAATTGATGTTTGG + Intergenic
1056134307 9:83616403-83616425 AGTTGTTAAAAGATAATAGCAGG - Intergenic
1056317375 9:85403109-85403131 AATTGCTTAAAAATCAGAGTAGG - Intergenic
1056376197 9:86014348-86014370 AGTTGATAAAAGATGATCTTCGG + Intronic
1203381467 Un_KI270435v1:51333-51355 AGATTCTACAAAATGACAGTTGG - Intergenic
1186199797 X:7145938-7145960 AGGTGCTAAAGAATGACAGCAGG + Intronic
1188171352 X:26931783-26931805 TGTTGCTCTAAAATAATAGTTGG + Intergenic
1188251573 X:27902296-27902318 AATTGCTCAAAAATAAAAGTAGG + Intergenic
1188575770 X:31648173-31648195 ATTTGCAAAAATATGATAGAAGG + Intronic
1189932494 X:46028927-46028949 AGTGGTTAAAAAATAACAGTTGG + Intergenic
1191708886 X:64126760-64126782 AATTACTGAAAAATGAAAGTTGG + Intergenic
1191896427 X:65998160-65998182 AGTTGCTCAAGAATGACGGTTGG - Intergenic
1191998079 X:67117946-67117968 AGTTGTTAAAAAGCAATAGTGGG - Intergenic
1192991181 X:76458770-76458792 AGTTGGTAAACAATTTTAGTAGG + Intergenic
1193325159 X:80171917-80171939 AGATGGTAAAAAATGAAAATTGG + Intergenic
1194935564 X:99943488-99943510 AGTTATTAAAACATGATAATAGG - Intergenic
1195604013 X:106781874-106781896 CGATGCTAGAAAATGATGGTGGG - Intronic
1195808208 X:108799518-108799540 AGTTTCTAAAACATGAACGTTGG - Intergenic
1196931817 X:120689273-120689295 TGTTGCTAGTAAATGATAATTGG - Intergenic
1197270322 X:124418078-124418100 ATTTTTTAAAAAATGAAAGTTGG + Intronic
1197358237 X:125464238-125464260 CTTTCCTAAAAAATGATAATGGG + Intergenic
1198176442 X:134160268-134160290 AATTTTTAAAAAATGATAATAGG + Intergenic
1199240573 X:145543493-145543515 CATTTCTAAATAATGATAGTGGG - Intergenic
1199885537 X:152017976-152017998 CCTTGCTAAAAAATGATTGAGGG - Intergenic